cyclin I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51846-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All cyclin I Reagents

CRO Services

Product recommended


All cyclin I Reagents

cyclin I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Mouse cyclin I with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

cyclin I Background Information

Full Name
cyclin I

cyclin I cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
cyclin I cDNA ORF Clone in Cloning Vector, Mouse MG51846-G
cyclin I cDNA ORF Clone, Mouse, untagged MG51846-UT
cyclin I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51846-ACGLN
cyclin I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51846-ACG
cyclin I cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51846-ANG
cyclin I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51846-ACR
cyclin I cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51846-ANR
cyclin I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51846-CF
cyclin I cDNA ORF Clone, Mouse, C-His tag MG51846-CH
cyclin I cDNA ORF Clone, Mouse, N-His tag MG51846-NH
cyclin I cDNA ORF Clone, Mouse, C-HA tag MG51846-CY
cyclin I cDNA ORF Clone, Mouse, N-HA tag MG51846-NY
cyclin I cDNA ORF Clone, Mouse, C-Myc tag MG51846-CM
cyclin I cDNA ORF Clone, Mouse, N-Myc tag MG51846-NM
cyclin I qPCR Primer Pairs, Mouse MP201719

cyclin I cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
cyclin I cDNA ORF Clone in Cloning Vector, Human HG16554-G
cyclin I cDNA ORF Clone, Human, untagged HG16554-UT
cyclin I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16554-ACGLN
cyclin I cDNA ORF Clone, Human, C-GFPSpark® tag HG16554-ACG
cyclin I cDNA ORF Clone, Human, N-GFPSpark® tag HG16554-ANG
cyclin I cDNA ORF Clone, Human, C-OFPSpark® tag HG16554-ACR
cyclin I cDNA ORF Clone, Human, N-OFPSpark® tag HG16554-ANR
cyclin I cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16554-CF
cyclin I cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16554-NF
cyclin I cDNA ORF Clone, Human, C-His tag HG16554-CH
cyclin I cDNA ORF Clone, Human, N-His tag HG16554-NH
cyclin I cDNA ORF Clone, Human, C-HA tag HG16554-CY
cyclin I cDNA ORF Clone, Human, N-HA tag HG16554-NY
cyclin I cDNA ORF Clone, Human, C-Myc tag HG16554-CM
cyclin I cDNA ORF Clone, Human, N-Myc tag HG16554-NM
cyclin I qPCR Primer Pairs, Human HP104828
info info
添加购物车成功! 添加购物车失败!