cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51009-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All cyclin D2/CCND2 Reagents

CRO Services

Product recommended


All cyclin D2/CCND2 Reagents

cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Mouse cyclin D2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

2600016F06Rik cDNA ORF Clone, Mouse;AI256817 cDNA ORF Clone, Mouse;BF642806 cDNA ORF Clone, Mouse;C86853 cDNA ORF Clone, Mouse;cD2 cDNA ORF Clone, Mouse;Vin-1 cDNA ORF Clone, Mouse;Vin1 cDNA ORF Clone, Mouse

cyclin D2/CCND2 Background Information

Full Name
cyclin D2

cyclin D2/CCND2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
cyclin D2/CCND2 cDNA ORF Clone in Cloning Vector, Canine DG70187-U
cyclin D2/CCND2 cDNA ORF Clone, Canine, untagged DG70187-UT
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70187-ACG
cyclin D2/CCND2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70187-ACGLN
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70187-ANG
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70187-ACR
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70187-ANR
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70187-CF
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70187-NF
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-His tag DG70187-CH
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-His tag DG70187-NH
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-HA tag DG70187-CY
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-HA tag DG70187-NY
cyclin D2/CCND2 cDNA ORF Clone, Canine, C-Myc tag DG70187-CM
cyclin D2/CCND2 cDNA ORF Clone, Canine, N-Myc tag DG70187-NM

cyclin D2/CCND2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
cyclin D2/CCND2 cDNA ORF Clone in Cloning Vector, Mouse MG51009-U
cyclin D2/CCND2 cDNA ORF Clone, Mouse, untagged MG51009-UT
cyclin D2/CCND2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51009-ACGLN
cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51009-ACG
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51009-ANG
cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51009-ACR
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51009-ANR
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51009-NF
cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-His tag MG51009-CH
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-His tag MG51009-NH
cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-HA tag MG51009-CY
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-HA tag MG51009-NY
cyclin D2/CCND2 cDNA ORF Clone, Mouse, C-Myc tag MG51009-CM
cyclin D2/CCND2 cDNA ORF Clone, Mouse, N-Myc tag MG51009-NM
cyclin D2/CCND2 qPCR Primer Pairs, Mouse MP200969

cyclin D2/CCND2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
cyclin D2/CCND2 cDNA ORF Clone in Cloning Vector, Human HG10921-M
cyclin D2/CCND2 cDNA ORF Clone, Human, untagged HG10921-UT
cyclin D2/CCND2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10921-ACG
cyclin D2/CCND2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10921-ACGLN
cyclin D2/CCND2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10921-ANG
cyclin D2/CCND2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10921-ACR
cyclin D2/CCND2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10921-ANR
cyclin D2/CCND2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10921-CF
cyclin D2/CCND2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10921-NF
cyclin D2/CCND2 cDNA ORF Clone, Human, C-His tag HG10921-CH
cyclin D2/CCND2 cDNA ORF Clone, Human, N-His tag HG10921-NH
cyclin D2/CCND2 cDNA ORF Clone, Human, C-HA tag HG10921-CY
cyclin D2/CCND2 cDNA ORF Clone, Human, N-HA tag HG10921-NY
cyclin D2/CCND2 cDNA ORF Clone, Human, C-Myc tag HG10921-CM
cyclin D2/CCND2 cDNA ORF Clone, Human, N-Myc tag HG10921-NM
cyclin D2/CCND2 qPCR Primer Pairs, Human HP100803
info info
添加购物车成功! 添加购物车失败!