BSCL2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52738-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BSCL2 Reagents

CRO Services

Product recommended


All BSCL2 Reagents

BSCL2 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1152 bp
Description
Full length Clone DNA of Mouse Bernardinelli-Seip congenital lipodystrophy 2 homolog (human) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BSCL2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

2900097C17Rik cDNA ORF Clone, Mouse;AI046355 cDNA ORF Clone, Mouse;Gng3lg cDNA ORF Clone, Mouse

BSCL2 Background Information

Full Name
Berardinelli-Seip congenital lipodystrophy 2 (seipin)

BSCL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Rat RG85008-U
BSCL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85008-ACGLN

BSCL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Mouse MG52738-G
BSCL2 cDNA ORF Clone, Mouse, untagged MG52738-UT
BSCL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52738-ACGLN
BSCL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52738-ACG
BSCL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52738-ACR
BSCL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52738-CF
BSCL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52738-NF
BSCL2 cDNA ORF Clone, Mouse, C-His tag MG52738-CH
BSCL2 cDNA ORF Clone, Mouse, N-His tag MG52738-NH
BSCL2 cDNA ORF Clone, Mouse, C-HA tag MG52738-CY
BSCL2 cDNA ORF Clone, Mouse, N-HA tag MG52738-NY
BSCL2 cDNA ORF Clone, Mouse, N-Myc tag MG52738-NM
BSCL2 qPCR Primer Pairs, Mouse MP202609

BSCL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BSCL2 cDNA ORF Clone in Cloning Vector, Human HG14081-G
BSCL2 cDNA ORF Clone, Human, untagged HG14081-UT
BSCL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14081-ACGLN
BSCL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14081-ACG
BSCL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14081-ACR
BSCL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14081-CF
BSCL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14081-NF
BSCL2 cDNA ORF Clone, Human, C-His tag HG14081-CH
BSCL2 cDNA ORF Clone, Human, N-His tag HG14081-NH
BSCL2 cDNA ORF Clone, Human, C-HA tag HG14081-CY
BSCL2 cDNA ORF Clone, Human, N-HA tag HG14081-NY
BSCL2 cDNA ORF Clone, Human, C-Myc tag HG14081-CM
BSCL2 cDNA ORF Clone, Human, N-Myc tag HG14081-NM
BSCL2 qPCR Primer Pairs, Human HP102735
info info
添加购物车成功! 添加购物车失败!