BLZF1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52016-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BLZF1 Reagents

CRO Services

Product recommended


All BLZF1 Reagents

BLZF1 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Mouse basic leucine zipper nuclear factor 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BLZF1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

1700030G05Rik cDNA ORF Clone, Mouse;Blzf1l cDNA ORF Clone, Mouse;Golgin-45 cDNA ORF Clone, Mouse;Jem-1 cDNA ORF Clone, Mouse

BLZF1 Background Information

Full Name
basic leucine zipper nuclear factor 1

BLZF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BLZF1 cDNA ORF Clone in Cloning Vector, Mouse MG52016-U
BLZF1 cDNA ORF Clone, Mouse, untagged MG52016-UT
BLZF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52016-ACG
BLZF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52016-ACGLN
BLZF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52016-ANG
BLZF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52016-ACR
BLZF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52016-ANR
BLZF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52016-CF
BLZF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52016-NF
BLZF1 cDNA ORF Clone, Mouse, C-His tag MG52016-CH
BLZF1 cDNA ORF Clone, Mouse, N-His tag MG52016-NH
BLZF1 cDNA ORF Clone, Mouse, C-HA tag MG52016-CY
BLZF1 cDNA ORF Clone, Mouse, N-HA tag MG52016-NY
BLZF1 cDNA ORF Clone, Mouse, C-Myc tag MG52016-CM
BLZF1 qPCR Primer Pairs, Mouse MP201889

BLZF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BLZF1 cDNA ORF Clone in Cloning Vector, Human HG15320-G
BLZF1 cDNA ORF Clone, Human, untagged HG15320-UT
BLZF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15320-ACG
BLZF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15320-ACGLN
BLZF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15320-ANG
BLZF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15320-ACR
BLZF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15320-ANR
BLZF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15320-CF
BLZF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15320-NF
BLZF1 cDNA ORF Clone, Human, C-His tag HG15320-CH
BLZF1 cDNA ORF Clone, Human, N-His tag HG15320-NH
BLZF1 cDNA ORF Clone, Human, C-HA tag HG15320-CY
BLZF1 cDNA ORF Clone, Human, N-HA tag HG15320-NY
BLZF1 cDNA ORF Clone, Human, C-Myc tag HG15320-CM
BLZF1 cDNA ORF Clone, Human, N-Myc tag HG15320-NM
BLZF1 qPCR Primer Pairs, Human HP103945
info info
添加购物车成功! 添加购物车失败!