BAFF cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50352-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BAFF Reagents

CRO Services

Product recommended


All BAFF Reagents

BAFF cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
975 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 13b with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.98kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BAFF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAFF cDNA ORF Clone, Mouse, C-Myc tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5611

BAFF cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

BAFF cDNA ORF Clone, Mouse;BLyS cDNA ORF Clone, Mouse;D8Ertd387e cDNA ORF Clone, Mouse;TALL-1 cDNA ORF Clone, Mouse;TALL1 cDNA ORF Clone, Mouse;THANK cDNA ORF Clone, Mouse;TNFSF20 cDNA ORF Clone, Mouse;zTNF4 cDNA ORF Clone, Mouse

BAFF Background Information

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 13b
Research Areas
References
  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • BAFF cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Rhesus CG90267-G
    BAFF cDNA ORF Clone, Rhesus, untagged CG90267-UT
    BAFF Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90267-ACGLN
    BAFF cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90267-ACG
    BAFF cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90267-ACR
    BAFF cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90267-CF
    BAFF cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90267-NF
    BAFF cDNA ORF Clone, Rhesus, C-His tag CG90267-CH
    BAFF cDNA ORF Clone, Rhesus, N-His tag CG90267-NH
    BAFF cDNA ORF Clone, Rhesus, C-HA tag CG90267-CY
    BAFF cDNA ORF Clone, Rhesus, N-HA tag CG90267-NY
    BAFF cDNA ORF Clone, Rhesus, C-Myc tag CG90267-CM
    BAFF cDNA ORF Clone, Rhesus, N-Myc tag CG90267-NM

    BAFF cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Canine DG70112-G

    BAFF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Mouse MG50352-M
    BAFF cDNA ORF Clone, Mouse, untagged MG50352-UT
    BAFF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50352-ACG
    BAFF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50352-ACGLN
    BAFF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50352-ACR
    BAFF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50352-CF
    BAFF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50352-NF
    BAFF cDNA ORF Clone, Mouse, C-His tag MG50352-CH
    BAFF cDNA ORF Clone, Mouse, N-His tag MG50352-NH
    BAFF cDNA ORF Clone, Mouse, C-HA tag MG50352-CY
    BAFF cDNA ORF Clone, Mouse, N-HA tag MG50352-NY
    BAFF cDNA ORF Clone, Mouse, N-Myc tag MG50352-NM
    BAFF qPCR Primer Pairs, Mouse MP200373

    BAFF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Human HG10056-M
    BAFF cDNA ORF Clone, Human, untagged HG10056-UT
    BAFF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10056-ACGLN
    BAFF cDNA ORF Clone, Human, C-GFPSpark® tag HG10056-ACG
    BAFF cDNA ORF Clone, Human, C-OFPSpark® tag HG10056-ACR
    BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10056-CF
    BAFF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10056-NF
    BAFF cDNA ORF Clone, Human, C-His tag HG10056-CH
    BAFF cDNA ORF Clone, Human, N-His tag HG10056-NH
    BAFF cDNA ORF Clone, Human, C-HA tag HG10056-CY
    BAFF cDNA ORF Clone, Human, N-HA tag HG10056-NY
    BAFF cDNA ORF Clone, Human, C-Myc tag HG10056-CM
    BAFF cDNA ORF Clone, Human, N-Myc tag HG10056-NM
    BAFF qPCR Primer Pairs, Human HP100144
    info info
    添加购物车成功! 添加购物车失败!