pro renin receptor cDNA ORF Clone, Mouse, untagged

Cat: MG51375-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All pro renin receptor Reagents
CRO Services
Product recommended

All pro renin receptor Reagents
pro renin receptor cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Mouse ATPase, H+ transporting, lysosomal accessory protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

pro renin receptor cDNA ORF Clone, Mouse, untagged Alternative Names
(P)RR cDNA ORF Clone, Mouse;5730403E06Rik cDNA ORF Clone, Mouse;APT6M8-9 cDNA ORF Clone, Mouse;Atp6ip2 cDNA ORF Clone, Mouse;ATP6M8-9 cDNA ORF Clone, Mouse;M8-9 cDNA ORF Clone, Mouse
pro renin receptor Background Information
Full Name
ATPase, H+ transporting, lysosomal accessory protein 2

pro renin receptor cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Rat RG82722-U
pro renin receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82722-ACGLN

pro renin receptor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Mouse MG51375-U
pro renin receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51375-ACGLN
pro renin receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51375-ACG
pro renin receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51375-ACR
pro renin receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51375-CF
pro renin receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51375-NF
pro renin receptor cDNA ORF Clone, Mouse, C-His tag MG51375-CH
pro renin receptor cDNA ORF Clone, Mouse, N-His tag MG51375-NH
pro renin receptor cDNA ORF Clone, Mouse, C-HA tag MG51375-CY
pro renin receptor cDNA ORF Clone, Mouse, N-HA tag MG51375-NY
pro renin receptor cDNA ORF Clone, Mouse, C-Myc tag MG51375-CM
pro renin receptor cDNA ORF Clone, Mouse, N-Myc tag MG51375-NM
pro renin receptor qPCR Primer Pairs, Mouse MP201248

pro renin receptor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Human HG11244-M
pro renin receptor cDNA ORF Clone, Human, untagged HG11244-UT
pro renin receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11244-ACGLN
pro renin receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG11244-ACG
pro renin receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG11244-ACR
pro renin receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11244-CF
pro renin receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11244-NF
pro renin receptor cDNA ORF Clone, Human, C-His tag HG11244-CH
pro renin receptor cDNA ORF Clone, Human, N-His tag HG11244-NH
pro renin receptor cDNA ORF Clone, Human, C-HA tag HG11244-CY
pro renin receptor cDNA ORF Clone, Human, N-HA tag HG11244-NY
pro renin receptor cDNA ORF Clone, Human, C-Myc tag HG11244-CM
pro renin receptor cDNA ORF Clone, Human, N-Myc tag HG11244-NM
pro renin receptor qPCR Primer Pairs, Human HP101188
info info
添加购物车成功! 添加购物车失败!