ADCK5 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51613-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ADCK5 Reagents
CRO Services
Product recommended

All ADCK5 Reagents
ADCK5 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Description
Full length Clone DNA of Mouse aarF domain containing kinase 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADCK5 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
A230108P17 cDNA ORF Clone, Mouse
ADCK5 Background Information
Full Name
aarF domain containing kinase 5

ADCK5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Rat RG81131-U
ADCK5 cDNA ORF Clone, Rat, untagged RG81131-UT
ADCK5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81131-ACG
ADCK5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81131-ACGLN
ADCK5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81131-ACR
ADCK5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81131-CF
ADCK5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81131-NF
ADCK5 cDNA ORF Clone, Rat, C-His tag RG81131-CH
ADCK5 cDNA ORF Clone, Rat, N-His tag RG81131-NH
ADCK5 cDNA ORF Clone, Rat, C-HA tag RG81131-CY
ADCK5 cDNA ORF Clone, Rat, N-HA tag RG81131-NY
ADCK5 cDNA ORF Clone, Rat, C-Myc tag RG81131-CM
ADCK5 cDNA ORF Clone, Rat, N-Myc tag RG81131-NM
ADCK5 qPCR Primer Pairs, Rat RP301088

ADCK5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Mouse MG51613-U
ADCK5 cDNA ORF Clone, Mouse, untagged MG51613-UT
ADCK5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51613-ACG
ADCK5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51613-ACGLN
ADCK5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51613-ACR
ADCK5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51613-CF
ADCK5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51613-NF
ADCK5 cDNA ORF Clone, Mouse, C-His tag MG51613-CH
ADCK5 cDNA ORF Clone, Mouse, N-His tag MG51613-NH
ADCK5 cDNA ORF Clone, Mouse, C-HA tag MG51613-CY
ADCK5 cDNA ORF Clone, Mouse, N-HA tag MG51613-NY
ADCK5 cDNA ORF Clone, Mouse, N-Myc tag MG51613-NM
ADCK5 qPCR Primer Pairs, Mouse MP201280

ADCK5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Human HG10071-M
ADCK5 cDNA ORF Clone, Human, untagged HG10071-UT
ADCK5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10071-ACGLN
ADCK5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10071-ACG
ADCK5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10071-ACR
ADCK5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10071-CF
ADCK5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10071-NF
ADCK5 cDNA ORF Clone, Human, C-His tag HG10071-CH
ADCK5 cDNA ORF Clone, Human, N-His tag HG10071-NH
ADCK5 cDNA ORF Clone, Human, C-HA tag HG10071-CY
ADCK5 cDNA ORF Clone, Human, N-HA tag HG10071-NY
ADCK5 cDNA ORF Clone, Human, C-Myc tag HG10071-CM
ADCK5 cDNA ORF Clone, Human, N-Myc tag HG10071-NM
ADCK5 qPCR Primer Pairs, Human HP100157
info info
添加购物车成功! 添加购物车失败!