ADCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51025-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADCK1 Reagents
CRO Services
Product recommended

All ADCK1 Reagents
ADCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Description
Full length Clone DNA of Mouse aarF domain containing kinase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2610005A10Rik cDNA ORF Clone, Mouse
ADCK1 Background Information
Full Name
aarF domain containing kinase 1

ADCK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADCK1 cDNA ORF Clone in Cloning Vector, Mouse MG51025-G
ADCK1 cDNA ORF Clone, Mouse, untagged MG51025-UT
ADCK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51025-ACG
ADCK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51025-ACGLN
ADCK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51025-ANG
ADCK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51025-ACR
ADCK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51025-ANR
ADCK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51025-NF
ADCK1 cDNA ORF Clone, Mouse, C-His tag MG51025-CH
ADCK1 cDNA ORF Clone, Mouse, N-His tag MG51025-NH
ADCK1 cDNA ORF Clone, Mouse, C-HA tag MG51025-CY
ADCK1 cDNA ORF Clone, Mouse, N-HA tag MG51025-NY
ADCK1 cDNA ORF Clone, Mouse, C-Myc tag MG51025-CM
ADCK1 cDNA ORF Clone, Mouse, N-Myc tag MG51025-NM
ADCK1 qPCR Primer Pairs, Mouse MP200984

ADCK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADCK1 cDNA ORF Clone in Cloning Vector, Human HG10792-G
ADCK1 cDNA ORF Clone, Human, untagged HG10792-UT
ADCK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10792-ACG
ADCK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10792-ACGLN
ADCK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10792-ACR
ADCK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10792-CF
ADCK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10792-NF
ADCK1 cDNA ORF Clone, Human, C-His tag HG10792-CH
ADCK1 cDNA ORF Clone, Human, N-His tag HG10792-NH
ADCK1 cDNA ORF Clone, Human, C-HA tag HG10792-CY
ADCK1 cDNA ORF Clone, Human, N-HA tag HG10792-NY
ADCK1 cDNA ORF Clone, Human, C-Myc tag HG10792-CM
ADCK1 cDNA ORF Clone, Human, N-Myc tag HG10792-NM
ADCK1 qPCR Primer Pairs, Human HP100706
info info
添加购物车成功! 添加购物车失败!