Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51014-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Acid Phosphatase Reagents
CRO Services
Product recommended

All Acid Phosphatase Reagents
Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Mouse acid phosphatase 1, soluble with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
4632432E04Rik cDNA ORF Clone, Mouse;Acp-1 cDNA ORF Clone, Mouse;AI427468 cDNA ORF Clone, Mouse;LMW-PTP cDNA ORF Clone, Mouse
Acid Phosphatase Background Information

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

Full Name
acid phosphatase 1, soluble
References
  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Acid Phosphatase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Acid Phosphatase cDNA ORF Clone in Cloning Vector, Rat RG82869-U
    Acid Phosphatase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82869-ACGLN

    Acid Phosphatase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Acid Phosphatase cDNA ORF Clone in Cloning Vector, Mouse MG51014-G
    Acid Phosphatase cDNA ORF Clone in Cloning Vector, Mouse MG5A7563-U
    Acid Phosphatase cDNA ORF Clone, Mouse, untagged MG51014-UT
    Acid Phosphatase cDNA ORF Clone, Mouse, untagged MG5A7563-UT
    Acid Phosphatase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7563-ACG
    Acid Phosphatase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7563-ACGLN
    Acid Phosphatase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51014-ACGLN
    Acid Phosphatase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51014-ACG
    Acid Phosphatase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51014-ANG
    Acid Phosphatase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7563-ANG
    Acid Phosphatase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51014-ACR
    Acid Phosphatase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7563-ACR
    Acid Phosphatase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51014-ANR
    Acid Phosphatase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7563-ANR
    Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7563-CF
    Acid Phosphatase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51014-NF
    Acid Phosphatase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7563-NF
    Acid Phosphatase cDNA ORF Clone, Mouse, C-His tag MG5A7563-CH
    Acid Phosphatase cDNA ORF Clone, Mouse, C-His tag MG51014-CH
    Acid Phosphatase cDNA ORF Clone, Mouse, N-His tag MG51014-NH
    Acid Phosphatase cDNA ORF Clone, Mouse, N-His tag MG5A7563-NH
    Acid Phosphatase cDNA ORF Clone, Mouse, C-HA tag MG5A7563-CY
    Acid Phosphatase cDNA ORF Clone, Mouse, C-HA tag MG51014-CY
    Acid Phosphatase cDNA ORF Clone, Mouse, N-HA tag MG5A7563-NY
    Acid Phosphatase cDNA ORF Clone, Mouse, N-HA tag MG51014-NY
    Acid Phosphatase cDNA ORF Clone, Mouse, C-Myc tag MG51014-CM
    Acid Phosphatase cDNA ORF Clone, Mouse, C-Myc tag MG5A7563-CM
    Acid Phosphatase cDNA ORF Clone, Mouse, N-Myc tag MG5A7563-NM
    Acid Phosphatase cDNA ORF Clone, Mouse, N-Myc tag MG51014-NM
    Acid Phosphatase qPCR Primer Pairs, Mouse MP201286

    Acid Phosphatase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Acid Phosphatase cDNA ORF Clone in Cloning Vector, Human HG10957-M
    Acid Phosphatase cDNA ORF Clone, Human, untagged HG10957-UT
    Acid Phosphatase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10957-ACGLN
    Acid Phosphatase cDNA ORF Clone, Human, C-GFPSpark® tag HG10957-ACG
    Acid Phosphatase cDNA ORF Clone, Human, N-GFPSpark® tag HG10957-ANG
    Acid Phosphatase cDNA ORF Clone, Human, C-OFPSpark® tag HG10957-ACR
    Acid Phosphatase cDNA ORF Clone, Human, N-OFPSpark® tag HG10957-ANR
    Acid Phosphatase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10957-CF
    Acid Phosphatase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10957-NF
    Acid Phosphatase cDNA ORF Clone, Human, C-His tag HG10957-CH
    Acid Phosphatase cDNA ORF Clone, Human, N-His tag HG10957-NH
    Acid Phosphatase cDNA ORF Clone, Human, C-HA tag HG10957-CY
    Acid Phosphatase cDNA ORF Clone, Human, N-HA tag HG10957-NY
    Acid Phosphatase cDNA ORF Clone, Human, C-Myc tag HG10957-CM
    Acid Phosphatase cDNA ORF Clone, Human, N-Myc tag HG10957-NM
    Acid Phosphatase qPCR Primer Pairs, Human HP100833
    info info
    添加购物车成功! 添加购物车失败!