AADAC cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

AADAC cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Description
Full length Clone DNA of Mouse arylacetamide deacetylase (esterase).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AADAC cDNA ORF Clone, Mouse, untagged: Alternative Names

5033417E09Rik cDNA ORF Clone, Mouse; Aada cDNA ORF Clone, Mouse; AI265437 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait