CD122 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50792-G-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD122 Reagents
CRO Services

All CD122 Reagents
CD122 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1620 bp
Sequence Description
Identical with the Gene Bank Ref.ID sequence.
Description
Full length Clone DNA of Mouse interleukin 2 receptor, beta chain with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI (5.5kb + 1.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD122 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD122 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse CD122 / IL-2RB Gene Plasmid Map 7617
CD122 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
CD122 cDNA ORF Clone, Mouse;IL-15Rbeta cDNA ORF Clone, Mouse;Il-2/15Rbeta cDNA ORF Clone, Mouse;Il-2Rbeta cDNA ORF Clone, Mouse;IL15Rbeta cDNA ORF Clone, Mouse;p70 cDNA ORF Clone, Mouse
CD122 Background Information

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

Full Name
interleukin 2 receptor, beta
References
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • CD122 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD122 cDNA ORF Clone in Cloning Vector, Rhesus CG90328-G
    CD122 cDNA ORF Clone, Rhesus, untagged CG90328-UT
    CD122 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90328-ACGLN
    CD122 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90328-ACG
    CD122 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90328-ACR
    CD122 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90328-CF
    CD122 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90328-NF
    CD122 cDNA ORF Clone, Rhesus, C-His tag CG90328-CH
    CD122 cDNA ORF Clone, Rhesus, N-His tag CG90328-NH
    CD122 cDNA ORF Clone, Rhesus, C-HA tag CG90328-CY
    CD122 cDNA ORF Clone, Rhesus, N-HA tag CG90328-NY
    CD122 cDNA ORF Clone, Rhesus, C-Myc tag CG90328-CM
    CD122 cDNA ORF Clone, Rhesus, N-Myc tag CG90328-NM

    CD122 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CD122 cDNA ORF Clone in Cloning Vector, Canine DG70082-G
    CD122 cDNA ORF Clone, Canine, untagged DG70082-UT
    CD122 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70082-ACGLN
    CD122 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70082-ACG
    CD122 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70082-ACR
    CD122 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70082-CF
    CD122 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70082-NF
    CD122 cDNA ORF Clone, Canine, C-His tag DG70082-CH
    CD122 cDNA ORF Clone, Canine, N-His tag DG70082-NH
    CD122 cDNA ORF Clone, Canine, C-HA tag DG70082-CY
    CD122 cDNA ORF Clone, Canine, N-HA tag DG70082-NY
    CD122 cDNA ORF Clone, Canine, C-Myc tag DG70082-CM
    CD122 cDNA ORF Clone, Canine, N-Myc tag DG70082-NM

    CD122 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD122 cDNA ORF Clone in Cloning Vector, Rat RG80340-G
    CD122 cDNA ORF Clone, Rat, untagged RG80340-UT
    CD122 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80340-ACG
    CD122 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80340-ACGLN
    CD122 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80340-ACR
    CD122 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80340-CF
    CD122 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80340-NF
    CD122 cDNA ORF Clone, Rat, C-His tag RG80340-CH
    CD122 cDNA ORF Clone, Rat, N-His tag RG80340-NH
    CD122 cDNA ORF Clone, Rat, C-HA tag RG80340-CY
    CD122 cDNA ORF Clone, Rat, N-HA tag RG80340-NY
    CD122 cDNA ORF Clone, Rat, C-Myc tag RG80340-CM
    CD122 cDNA ORF Clone, Rat, N-Myc tag RG80340-NM
    CD122 qPCR Primer Pairs, Rat RP300310

    CD122 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD122 cDNA ORF Clone in Cloning Vector, Mouse MG50792-G
    CD122 cDNA ORF Clone, Mouse, untagged MG50792-UT
    CD122 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50792-ACGLN
    CD122 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50792-ACG
    CD122 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50792-ACR
    CD122 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50792-CF
    CD122 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50792-NF
    CD122 cDNA ORF Clone, Mouse, C-His tag MG50792-CH
    CD122 cDNA ORF Clone, Mouse, N-His tag MG50792-NH
    CD122 cDNA ORF Clone, Mouse, C-HA tag MG50792-CY
    CD122 cDNA ORF Clone, Mouse, N-HA tag MG50792-NY
    CD122 cDNA ORF Clone, Mouse, C-Myc tag MG50792-CM
    CD122 cDNA ORF Clone, Mouse, N-Myc tag MG50792-NM
    CD122 qPCR Primer Pairs, Mouse MP200765

    CD122 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD122 cDNA ORF Clone in Cloning Vector, Human HG10696-U
    CD122 cDNA ORF Clone, Human, untagged HG10696-UT
    CD122 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10696-ACGLN
    CD122 cDNA ORF Clone, Human, C-GFPSpark® tag HG10696-ACG
    CD122 cDNA ORF Clone, Human, C-OFPSpark® tag HG10696-ACR
    CD122 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10696-CF
    CD122 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10696-NF
    CD122 cDNA ORF Clone, Human, C-His tag HG10696-CH
    CD122 cDNA ORF Clone, Human, N-His tag HG10696-NH
    CD122 cDNA ORF Clone, Human, C-HA tag HG10696-CY
    CD122 cDNA ORF Clone, Human, N-HA tag HG10696-NY
    CD122 cDNA ORF Clone, Human, C-Myc tag HG10696-CM
    CD122 cDNA ORF Clone, Human, N-Myc tag HG10696-NM
    CD122 qPCR Primer Pairs, Human HP100651
    info info
    添加购物车成功! 添加购物车失败!