IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
534 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor antagonist (IL1RN), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI (5.5kb + 0.56kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL1RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

DIRA cDNA ORF Clone, Human; ICIL-1RA cDNA ORF Clone, Human; IL-1ra cDNA ORF Clone, Human; IL-1ra3 cDNA ORF Clone, Human; IL-1RN cDNA ORF Clone, Human; IL1F3 cDNA ORF Clone, Human; IL1RA cDNA ORF Clone, Human; IRAP cDNA ORF Clone, Human; MVCD4 cDNA ORF Clone, Human

IL1RA Background Information

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.
Full Name
interleukin 1 receptor antagonist
References
  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.

IL1RA cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait