IL11RA cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10252-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL11RA Reagents
CRO Services

All IL11RA Reagents
IL11RA cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 11 receptor, alpha (IL11RA), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.32kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL11RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL11RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CRSDA cDNA ORF Clone, Human;hCG_2011440 cDNA ORF Clone, Human;IL11RA cDNA ORF Clone, Human;MGC2146 cDNA ORF Clone, Human
IL11RA Background Information

Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of the hematopoietic cytokine receptor family. IL11RA/IL-11RA is expressed in a number of cell lines, including the myelogenous leukemia cell line K562, the megakaryocytic leukemia cell line Mo7E, the erythroleukemia cell line TF1, and the osteosarcoma cell lines, MG-63 and Saos-2. It is also expressed in normal and malignant prostate epithelial cell lines. Expression levels are increased in prostate carcinoma. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus, and three variants encoding two different isoforms have been identified. IL11RA/IL-11RA is a receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. Defects in IL11RA/IL-11RA are a cause of craniosynostosis and dental anomalies (CRSDA). CRSDA is a disorder characterized by craniosynostosis, maxillary hypoplasia, and dental anomalies, including malocclusion, delayed and ectopic tooth eruption, and/or supernumerary teeth. Some patients also display minor digit anomalies, such as syndactyly and/or clinodactyly.

Full Name
interleukin 11 receptor subunit alpha
References
  • Van Leuven F, et al. (1996) Molecular cloning and characterization of the human interleukin-11 receptor alpha-chain gene, IL11RA, located on chromosome 9p13. Genomics. 31 (1): 65-70.
  • Yoshizaki A, et al. (2006) Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the invasive and proliferative activity of human colorectal carcinoma cells. Int J Oncol. 29 (4): 869-76.
  • Karube K, et al. (2006) Gene expression profile of cytokines and chemokines in microdissected primary Hodgkin and Reed-Sternberg (HRS) cells: high expression of interleukin-11 receptor alpha. Ann Oncol. 17 (1): 110-6.
  • IL11RA cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL11RA cDNA ORF Clone in Cloning Vector, Canine DG70078-G
    IL11RA cDNA ORF Clone, Canine, untagged DG70078-UT
    IL11RA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70078-ACGLN
    IL11RA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70078-ACG
    IL11RA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70078-ACR
    IL11RA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70078-CF
    IL11RA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70078-NF
    IL11RA cDNA ORF Clone, Canine, C-His tag DG70078-CH
    IL11RA cDNA ORF Clone, Canine, N-His tag DG70078-NH
    IL11RA cDNA ORF Clone, Canine, C-HA tag DG70078-CY
    IL11RA cDNA ORF Clone, Canine, N-HA tag DG70078-NY
    IL11RA cDNA ORF Clone, Canine, C-Myc tag DG70078-CM
    IL11RA cDNA ORF Clone, Canine, N-Myc tag DG70078-NM

    IL11RA cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL11RA cDNA ORF Clone in Cloning Vector, Rhesus CG90126-G
    IL11RA cDNA ORF Clone, Rhesus, untagged CG90126-UT
    IL11RA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90126-ACGLN
    IL11RA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90126-ACG
    IL11RA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90126-ACR
    IL11RA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90126-CF
    IL11RA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90126-NF
    IL11RA cDNA ORF Clone, Rhesus, C-His tag CG90126-CH
    IL11RA cDNA ORF Clone, Rhesus, N-His tag CG90126-NH
    IL11RA cDNA ORF Clone, Rhesus, C-HA tag CG90126-CY
    IL11RA cDNA ORF Clone, Rhesus, N-HA tag CG90126-NY
    IL11RA cDNA ORF Clone, Rhesus, C-Myc tag CG90126-CM
    IL11RA cDNA ORF Clone, Rhesus, N-Myc tag CG90126-NM

    IL11RA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL11RA cDNA ORF Clone in Cloning Vector, Mouse MG50075-M
    IL11RA cDNA ORF Clone, Mouse, untagged MG50075-UT
    IL11RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50075-ACGLN
    IL11RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50075-ACG
    IL11RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50075-ACR
    IL11RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50075-CF
    IL11RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50075-NF
    IL11RA cDNA ORF Clone, Mouse, C-His tag MG50075-CH
    IL11RA cDNA ORF Clone, Mouse, N-His tag MG50075-NH
    IL11RA cDNA ORF Clone, Mouse, C-HA tag MG50075-CY
    IL11RA cDNA ORF Clone, Mouse, N-HA tag MG50075-NY
    IL11RA cDNA ORF Clone, Mouse, C-Myc tag MG50075-CM
    IL11RA cDNA ORF Clone, Mouse, N-Myc tag MG50075-NM
    IL11RA qPCR Primer Pairs, Mouse MP200106

    IL11RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL11RA cDNA ORF Clone in Cloning Vector, Human HG10252-M
    IL11RA cDNA ORF Clone, Human, untagged HG10252-UT
    IL11RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10252-ACG
    IL11RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10252-ACGLN
    IL11RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10252-ACR
    IL11RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10252-CF
    IL11RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10252-NF
    IL11RA cDNA ORF Clone, Human, C-His tag HG10252-CH
    IL11RA cDNA ORF Clone, Human, N-His tag HG10252-NH
    IL11RA cDNA ORF Clone, Human, C-HA tag HG10252-CY
    IL11RA cDNA ORF Clone, Human, N-HA tag HG10252-NY
    IL11RA cDNA ORF Clone, Human, C-Myc tag HG10252-CM
    IL11RA cDNA ORF Clone, Human, N-Myc tag HG10252-NM
    IL11RA qPCR Primer Pairs, Human HP100302

    IL11RA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL11RA qPCR Primer Pairs, Rat RP300172
    info info
    添加购物车成功! 添加购物车失败!