sFRP-5 cDNA ORF Clone, Human, N-His tag

Cat: HG10744-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All sFRP-5 Reagents

CRO Services

Product recommended


All sFRP-5 Reagents

sFRP-5 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Human secreted frizzled-related protein 5 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

sFRP-5 cDNA ORF Clone, Human, N-His tag Alternative Names

SARP3 cDNA ORF Clone, Human

sFRP-5 Background Information

Full Name
secreted frizzled-related protein 5

sFRP-5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
sFRP-5 cDNA ORF Clone in Cloning Vector, Mouse MG50056-M
sFRP-5 cDNA ORF Clone, Mouse, untagged MG50056-UT
sFRP-5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50056-ACGLN
sFRP-5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50056-ACG
sFRP-5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50056-ACR
sFRP-5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50056-CF
sFRP-5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50056-NF
sFRP-5 cDNA ORF Clone, Mouse, C-His tag MG50056-CH
sFRP-5 cDNA ORF Clone, Mouse, N-His tag MG50056-NH
sFRP-5 cDNA ORF Clone, Mouse, C-HA tag MG50056-CY
sFRP-5 cDNA ORF Clone, Mouse, N-HA tag MG50056-NY
sFRP-5 cDNA ORF Clone, Mouse, C-Myc tag MG50056-CM
sFRP-5 cDNA ORF Clone, Mouse, N-Myc tag MG50056-NM
sFRP-5 qPCR Primer Pairs, Mouse MP200056

sFRP-5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
sFRP-5 cDNA ORF Clone in Cloning Vector, Human HG10744-M
sFRP-5 cDNA ORF Clone, Human, untagged HG10744-UT
sFRP-5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10744-ACG
sFRP-5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10744-ACGLN
sFRP-5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10744-ACR
sFRP-5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10744-CF
sFRP-5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10744-NF
sFRP-5 cDNA ORF Clone, Human, C-His tag HG10744-CH
sFRP-5 cDNA ORF Clone, Human, C-HA tag HG10744-CY
sFRP-5 cDNA ORF Clone, Human, N-HA tag HG10744-NY
sFRP-5 cDNA ORF Clone, Human, C-Myc tag HG10744-CM
sFRP-5 cDNA ORF Clone, Human, N-Myc tag HG10744-NM
sFRP-5 qPCR Primer Pairs, Human HP100677
info info
添加购物车成功! 添加购物车失败!