Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag

Cat: VG40042-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RSV Fusion Reagents
CRO Services
Product recommended

All RSV Fusion Reagents
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
RSV
RefSeq ORF Size
1755 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03420.
Description
Full length Clone DNA of Human RSV (subtype A, strain A2) Fusion glycoprotein / RSV-F with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI(6kb+1.76kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RSV Fusion cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag Alternative Names
F cDNA ORF Clone, RSV;HRSVgp08 cDNA ORF Clone, RSV
RSV Fusion Background Information

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • RSV Fusion cDNA ORF Clone, RSV, Related Products

    Product Name Catalog#(PDF)
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40037-G
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40039-G
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40042-UT
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40037-UT
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40039-UT
    Human respiratory syncytial virus (RSV) (subtype A, A2001/2-20) RSV-F ORF mammalian expression plasmid (Codon Optimized) VG40098-G-N
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40042-ACG
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40037-ACGLN
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40042-ACGLN
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40039-ACGLN
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40037-ACG
    Human respiratory syncytial virus (RSV) (subtype A, A2001/2-20) RSV-F Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40098-ACGLN
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40039-ACG
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40042-ACR
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40037-ACR
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40039-ACR
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40042-CF
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40037-CF
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40039-CF
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40037-NF
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40039-NF
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40042-NF
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40042-CH
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40037-CH
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40039-CH
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40039-NH
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40037-NH
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40037-CY
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40039-CY
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40042-CY
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40037-NY
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40042-NY
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40039-NY
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40039-CM
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40042-CM
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40037-CM
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40042-NM
    Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40037-NM
    Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40039-NM
    info info
    添加购物车成功! 添加购物车失败!