Neuregulin-1 cDNA ORF Clone, Human, untagged

Cat: HG10658-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Neuregulin-1 Reagents
CRO Services
Product recommended

All Neuregulin-1 Reagents
Neuregulin-1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1914 bp
Description
Full length Clone DNA of Human neuregulin 1 transcript variant HRG-beta2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neuregulin-1 cDNA ORF Clone, Human, untagged Alternative Names
ARIA cDNA ORF Clone, Human;GGF cDNA ORF Clone, Human;GGF2 cDNA ORF Clone, Human;HGL cDNA ORF Clone, Human;HRG cDNA ORF Clone, Human;HRG1 cDNA ORF Clone, Human;HRGA cDNA ORF Clone, Human;MST131 cDNA ORF Clone, Human;MSTP131 cDNA ORF Clone, Human;NDF cDNA ORF Clone, Human;Neuregulin 1 cDNA ORF Clone, Human;NRG1-IT2 cDNA ORF Clone, Human;SMDF cDNA ORF Clone, Human
Neuregulin-1 Background Information

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

Full Name
neuregulin 1
References
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Neuregulin-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Neuregulin-1 cDNA ORF Clone in Cloning Vector, Canine DG70084-G
    Neuregulin-1 cDNA ORF Clone, Canine, untagged DG70084-UT
    Neuregulin-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70084-ACG
    Neuregulin-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70084-ACGLN
    Neuregulin-1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70084-ANG
    Neuregulin-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70084-ACR
    Neuregulin-1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70084-ANR
    Neuregulin-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70084-CF
    Neuregulin-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70084-NF
    Neuregulin-1 cDNA ORF Clone, Canine, C-His tag DG70084-CH
    Neuregulin-1 cDNA ORF Clone, Canine, N-His tag DG70084-NH
    Neuregulin-1 cDNA ORF Clone, Canine, C-HA tag DG70084-CY
    Neuregulin-1 cDNA ORF Clone, Canine, N-HA tag DG70084-NY
    Neuregulin-1 cDNA ORF Clone, Canine, C-Myc tag DG70084-CM
    Neuregulin-1 cDNA ORF Clone, Canine, N-Myc tag DG70084-NM

    Neuregulin-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Neuregulin-1 cDNA ORF Clone in Cloning Vector, Human HG10658-M
    Neuregulin-1 cDNA ORF Clone in Cloning Vector, Human HG11609-M
    Neuregulin-1 cDNA ORF Clone, Human, untagged HG11609-UT
    Neuregulin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11609-ACG
    Neuregulin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11609-ACGLN
    Neuregulin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10658-ACG
    Neuregulin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10658-ACGLN
    Neuregulin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10658-ACR
    Neuregulin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11609-ACR
    Neuregulin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10658-CF
    Neuregulin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11609-CF
    Neuregulin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11609-NF
    Neuregulin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10658-NF
    Neuregulin-1 cDNA ORF Clone, Human, C-His tag HG10658-CH
    Neuregulin-1 cDNA ORF Clone, Human, C-His tag HG11609-CH
    Neuregulin-1 cDNA ORF Clone, Human, N-His tag HG10658-NH
    Neuregulin-1 cDNA ORF Clone, Human, N-His tag HG11609-NH
    Neuregulin-1 cDNA ORF Clone, Human, C-HA tag HG10658-CY
    Neuregulin-1 cDNA ORF Clone, Human, C-HA tag HG11609-CY
    Neuregulin-1 cDNA ORF Clone, Human, N-HA tag HG11609-NY
    Neuregulin-1 cDNA ORF Clone, Human, N-HA tag HG10658-NY
    Neuregulin-1 cDNA ORF Clone, Human, C-Myc tag HG11609-CM
    Neuregulin-1 cDNA ORF Clone, Human, C-Myc tag HG10658-CM
    Neuregulin-1 cDNA ORF Clone, Human, N-Myc tag HG11609-NM
    Neuregulin-1 cDNA ORF Clone, Human, N-Myc tag HG10658-NM
    Neuregulin-1 qPCR Primer Pairs, Human HP100872
    info info
    添加购物车成功! 添加购物车失败!