WDR45 cDNA ORF Clone, Human, C-His tag

Cat: HG16339-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All WDR45 Reagents

CRO Services

Product recommended


All WDR45 Reagents

WDR45 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Description
Full length Clone DNA of Human WD repeat domain 45 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR45 cDNA ORF Clone, Human, C-His tag Alternative Names

JM5 cDNA ORF Clone, Human;NBIA4 cDNA ORF Clone, Human;NBIA5 cDNA ORF Clone, Human;WDRX1 cDNA ORF Clone, Human;WIPI-4 cDNA ORF Clone, Human;WIPI4 cDNA ORF Clone, Human

WDR45 Background Information

Full Name
WD repeat domain 45

WDR45 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
WDR45 cDNA ORF Clone in Cloning Vector, Rhesus CG90495-G
WDR45 cDNA ORF Clone, Rhesus, untagged CG90495-UT
WDR45 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90495-ACG
WDR45 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90495-ACGLN
WDR45 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90495-ANG
WDR45 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90495-ACR
WDR45 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90495-ANR
WDR45 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90495-CF
WDR45 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90495-NF
WDR45 cDNA ORF Clone, Rhesus, C-His tag CG90495-CH
WDR45 cDNA ORF Clone, Rhesus, N-His tag CG90495-NH
WDR45 cDNA ORF Clone, Rhesus, C-HA tag CG90495-CY
WDR45 cDNA ORF Clone, Rhesus, N-HA tag CG90495-NY
WDR45 cDNA ORF Clone, Rhesus, C-Myc tag CG90495-CM
WDR45 cDNA ORF Clone, Rhesus, N-Myc tag CG90495-NM

WDR45 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
WDR45 cDNA ORF Clone in Cloning Vector, Canine DG70248-U
WDR45 cDNA ORF Clone, Canine, untagged DG70248-UT
WDR45 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70248-ACG
WDR45 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70248-ACGLN
WDR45 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70248-ANG
WDR45 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70248-ACR
WDR45 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70248-ANR
WDR45 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70248-CF
WDR45 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70248-NF
WDR45 cDNA ORF Clone, Canine, C-His tag DG70248-CH
WDR45 cDNA ORF Clone, Canine, N-His tag DG70248-NH
WDR45 cDNA ORF Clone, Canine, C-HA tag DG70248-CY
WDR45 cDNA ORF Clone, Canine, N-HA tag DG70248-NY
WDR45 cDNA ORF Clone, Canine, C-Myc tag DG70248-CM
WDR45 cDNA ORF Clone, Canine, N-Myc tag DG70248-NM

WDR45 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR45 cDNA ORF Clone in Cloning Vector, Mouse MG51404-U
WDR45 cDNA ORF Clone, Mouse, untagged MG51404-UT
WDR45 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51404-ACG
WDR45 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51404-ACGLN
WDR45 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51404-ANG
WDR45 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51404-ACR
WDR45 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51404-ANR
WDR45 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51404-CF
WDR45 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51404-NF
WDR45 cDNA ORF Clone, Mouse, C-His tag MG51404-CH
WDR45 cDNA ORF Clone, Mouse, N-His tag MG51404-NH
WDR45 cDNA ORF Clone, Mouse, C-HA tag MG51404-CY
WDR45 cDNA ORF Clone, Mouse, N-HA tag MG51404-NY
WDR45 cDNA ORF Clone, Mouse, C-Myc tag MG51404-CM
WDR45 cDNA ORF Clone, Mouse, N-Myc tag MG51404-NM
WDR45 qPCR Primer Pairs, Mouse MP201288

WDR45 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR45 cDNA ORF Clone in Cloning Vector, Human HG16339-G
WDR45 cDNA ORF Clone, Human, untagged HG16339-UT
WDR45 cDNA ORF Clone, Human, C-GFPSpark® tag HG16339-ACG
WDR45 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16339-ACGLN
WDR45 cDNA ORF Clone, Human, N-GFPSpark® tag HG16339-ANG
WDR45 cDNA ORF Clone, Human, C-OFPSpark® tag HG16339-ACR
WDR45 cDNA ORF Clone, Human, N-OFPSpark® tag HG16339-ANR
WDR45 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16339-CF
WDR45 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16339-NF
WDR45 cDNA ORF Clone, Human, N-His tag HG16339-NH
WDR45 cDNA ORF Clone, Human, C-HA tag HG16339-CY
WDR45 cDNA ORF Clone, Human, N-HA tag HG16339-NY
WDR45 cDNA ORF Clone, Human, C-Myc tag HG16339-CM
WDR45 cDNA ORF Clone, Human, N-Myc tag HG16339-NM
WDR45 qPCR Primer Pairs, Human HP105092
info info
添加购物车成功! 添加购物车失败!