VDR cDNA ORF Clone, Human, untagged

Cat: HG12025-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All VDR Reagents

CRO Services

Product recommended


All VDR Reagents

VDR cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vitamin D (1,25- dihydroxyvitamin D3) receptor.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.28kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VDR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VDR cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

VDR cDNA ORF Clone, Human, untagged Alternative Names

NR1I1 cDNA ORF Clone, Human;PPP1R163 cDNA ORF Clone, Human

VDR Background Information

VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

Full Name
vitamin D (1,25- dihydroxyvitamin D3) receptor
References
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • VDR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VDR cDNA ORF Clone in Cloning Vector, Mouse MG51106-G
    VDR cDNA ORF Clone, Mouse, untagged MG51106-UT
    VDR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51106-ACGLN
    VDR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51106-ACG
    VDR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51106-ANG
    VDR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51106-ACR
    VDR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51106-ANR
    VDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51106-CF
    VDR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51106-NF
    VDR cDNA ORF Clone, Mouse, C-His tag MG51106-CH
    VDR cDNA ORF Clone, Mouse, N-His tag MG51106-NH
    VDR cDNA ORF Clone, Mouse, C-HA tag MG51106-CY
    VDR cDNA ORF Clone, Mouse, N-HA tag MG51106-NY
    VDR cDNA ORF Clone, Mouse, C-Myc tag MG51106-CM
    VDR cDNA ORF Clone, Mouse, N-Myc tag MG51106-NM
    VDR qPCR Primer Pairs, Mouse MP201059

    VDR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VDR cDNA ORF Clone in Cloning Vector, Human HG12025-G
    VDR cDNA ORF Clone, Human, C-GFPSpark® tag HG12025-ACG
    VDR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12025-ACGLN
    VDR cDNA ORF Clone, Human, N-GFPSpark® tag HG12025-ANG
    VDR cDNA ORF Clone, Human, C-OFPSpark® tag HG12025-ACR
    VDR cDNA ORF Clone, Human, N-OFPSpark® tag HG12025-ANR
    VDR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12025-CF
    VDR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12025-NF
    VDR cDNA ORF Clone, Human, C-His tag HG12025-CH
    VDR cDNA ORF Clone, Human, N-His tag HG12025-NH
    VDR cDNA ORF Clone, Human, C-HA tag HG12025-CY
    VDR cDNA ORF Clone, Human, N-HA tag HG12025-NY
    VDR cDNA ORF Clone, Human, C-Myc tag HG12025-CM
    VDR cDNA ORF Clone, Human, N-Myc tag HG12025-NM
    VDR qPCR Primer Pairs, Human HP101561
    info info
    添加购物车成功! 添加购物车失败!