UCHL5 cDNA ORF Clone, Human, N-HA tag

Cat: HG16407-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All UCHL5 Reagents

CRO Services

Product recommended


All UCHL5 Reagents

UCHL5 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human ubiquitin carboxyl-terminal hydrolase L5 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UCHL5 cDNA ORF Clone, Human, N-HA tag Alternative Names

CGI-70 cDNA ORF Clone, Human;INO80R cDNA ORF Clone, Human;UCH-L5 cDNA ORF Clone, Human;UCH37 cDNA ORF Clone, Human

UCHL5 Background Information

Full Name
ubiquitin C-terminal hydrolase L5

UCHL5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UCHL5 cDNA ORF Clone in Cloning Vector, Mouse MG52709-U
UCHL5 cDNA ORF Clone, Mouse, untagged MG52709-UT
UCHL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52709-ACG
UCHL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52709-ACGLN
UCHL5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52709-ANG
UCHL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52709-ACR
UCHL5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52709-ANR
UCHL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52709-CF
UCHL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52709-NF
UCHL5 cDNA ORF Clone, Mouse, C-His tag MG52709-CH
UCHL5 cDNA ORF Clone, Mouse, N-His tag MG52709-NH
UCHL5 cDNA ORF Clone, Mouse, C-HA tag MG52709-CY
UCHL5 cDNA ORF Clone, Mouse, N-HA tag MG52709-NY
UCHL5 cDNA ORF Clone, Mouse, C-Myc tag MG52709-CM
UCHL5 cDNA ORF Clone, Mouse, N-Myc tag MG52709-NM
UCHL5 qPCR Primer Pairs, Mouse MP202580

UCHL5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UCHL5 cDNA ORF Clone in Cloning Vector, Human HG16407-G
UCHL5 cDNA ORF Clone, Human, untagged HG16407-UT
UCHL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16407-ACG
UCHL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16407-ACGLN
UCHL5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16407-ANG
UCHL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16407-ACR
UCHL5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16407-ANR
UCHL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16407-CF
UCHL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16407-NF
UCHL5 cDNA ORF Clone, Human, C-His tag HG16407-CH
UCHL5 cDNA ORF Clone, Human, N-His tag HG16407-NH
UCHL5 cDNA ORF Clone, Human, C-HA tag HG16407-CY
UCHL5 cDNA ORF Clone, Human, C-Myc tag HG16407-CM
UCHL5 cDNA ORF Clone, Human, N-Myc tag HG16407-NM
UCHL5 qPCR Primer Pairs, Human HP105156
info info
添加购物车成功! 添加购物车失败!