beta-III Tubulin cDNA ORF Clone, Human, N-Myc tag

Cat: HG13121-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All beta-III Tubulin Reagents
CRO Services
Product recommended

All beta-III Tubulin Reagents
beta-III Tubulin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1353 bp
Description
Full length Clone DNA of Human tubulin, beta 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-III Tubulin cDNA ORF Clone, Human, N-Myc tag Alternative Names
beta-4 cDNA ORF Clone, Human;CDCBM cDNA ORF Clone, Human;CDCBM1 cDNA ORF Clone, Human;CFEOM3 cDNA ORF Clone, Human;CFEOM3A cDNA ORF Clone, Human;FEOM3 cDNA ORF Clone, Human;TUBB4 cDNA ORF Clone, Human
beta-III Tubulin Background Information
Full Name
tubulin, beta 3 class III

beta-III Tubulin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Rat RG80969-U
beta-III Tubulin cDNA ORF Clone, Rat, untagged RG80969-UT
beta-III Tubulin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80969-ACG
beta-III Tubulin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80969-ACGLN
beta-III Tubulin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80969-ANG
beta-III Tubulin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80969-ACR
beta-III Tubulin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80969-ANR
beta-III Tubulin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80969-CF
beta-III Tubulin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80969-NF
beta-III Tubulin cDNA ORF Clone, Rat, C-His tag RG80969-CH
beta-III Tubulin cDNA ORF Clone, Rat, N-His tag RG80969-NH
beta-III Tubulin cDNA ORF Clone, Rat, C-HA tag RG80969-CY
beta-III Tubulin cDNA ORF Clone, Rat, N-HA tag RG80969-NY
beta-III Tubulin cDNA ORF Clone, Rat, C-Myc tag RG80969-CM
beta-III Tubulin cDNA ORF Clone, Rat, N-Myc tag RG80969-NM
beta-III Tubulin qPCR Primer Pairs, Rat RP300933

beta-III Tubulin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Mouse MG51063-G
beta-III Tubulin cDNA ORF Clone, Mouse, untagged MG51063-UT
beta-III Tubulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51063-ACG
beta-III Tubulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51063-ACGLN
beta-III Tubulin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51063-ANG
beta-III Tubulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51063-ACR
beta-III Tubulin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51063-ANR
beta-III Tubulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51063-CF
beta-III Tubulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51063-NF
beta-III Tubulin cDNA ORF Clone, Mouse, C-His tag MG51063-CH
beta-III Tubulin cDNA ORF Clone, Mouse, N-His tag MG51063-NH
beta-III Tubulin cDNA ORF Clone, Mouse, C-HA tag MG51063-CY
beta-III Tubulin cDNA ORF Clone, Mouse, N-HA tag MG51063-NY
beta-III Tubulin cDNA ORF Clone, Mouse, C-Myc tag MG51063-CM
beta-III Tubulin cDNA ORF Clone, Mouse, N-Myc tag MG51063-NM
beta-III Tubulin qPCR Primer Pairs, Mouse MP201020

beta-III Tubulin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Human HG13121-G
beta-III Tubulin cDNA ORF Clone, Human, untagged HG13121-UT
beta-III Tubulin cDNA ORF Clone, Human, C-GFPSpark® tag HG13121-ACG
beta-III Tubulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13121-ACGLN
beta-III Tubulin cDNA ORF Clone, Human, N-GFPSpark® tag HG13121-ANG
beta-III Tubulin cDNA ORF Clone, Human, C-OFPSpark® tag HG13121-ACR
beta-III Tubulin cDNA ORF Clone, Human, N-OFPSpark® tag HG13121-ANR
beta-III Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13121-CF
beta-III Tubulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13121-NF
beta-III Tubulin cDNA ORF Clone, Human, C-His tag HG13121-CH
beta-III Tubulin cDNA ORF Clone, Human, N-His tag HG13121-NH
beta-III Tubulin cDNA ORF Clone, Human, C-HA tag HG13121-CY
beta-III Tubulin cDNA ORF Clone, Human, N-HA tag HG13121-NY
beta-III Tubulin cDNA ORF Clone, Human, C-Myc tag HG13121-CM
beta-III Tubulin qPCR Primer Pairs, Human HP101742
info info
添加购物车成功! 添加购物车失败!