TSPAN31 cDNA ORF Clone, Human, untagged

Cat: HG14231-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TSPAN31 Reagents

CRO Services

Product recommended


All TSPAN31 Reagents

TSPAN31 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
633 bp
Description
Full length Clone DNA of Human tetraspanin 31.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSPAN31 cDNA ORF Clone, Human, untagged Alternative Names

SAS cDNA ORF Clone, Human

TSPAN31 Background Information

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

Full Name
tetraspanin 31
References
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • TSPAN31 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TSPAN31 cDNA ORF Clone in Cloning Vector, Rat RG81110-U
    TSPAN31 cDNA ORF Clone, Rat, untagged RG81110-UT
    TSPAN31 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81110-ACGLN
    TSPAN31 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81110-ACG
    TSPAN31 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81110-ACR
    TSPAN31 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81110-CF
    TSPAN31 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81110-NF
    TSPAN31 cDNA ORF Clone, Rat, C-His tag RG81110-CH
    TSPAN31 cDNA ORF Clone, Rat, N-His tag RG81110-NH
    TSPAN31 cDNA ORF Clone, Rat, C-HA tag RG81110-CY
    TSPAN31 cDNA ORF Clone, Rat, N-HA tag RG81110-NY
    TSPAN31 cDNA ORF Clone, Rat, C-Myc tag RG81110-CM
    TSPAN31 cDNA ORF Clone, Rat, N-Myc tag RG81110-NM
    TSPAN31 qPCR Primer Pairs, Rat RP301067

    TSPAN31 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TSPAN31 cDNA ORF Clone in Cloning Vector, Mouse MG51899-G
    TSPAN31 cDNA ORF Clone, Mouse, untagged MG51899-UT
    TSPAN31 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51899-ACG
    TSPAN31 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51899-ACGLN
    TSPAN31 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51899-ACR
    TSPAN31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51899-CF
    TSPAN31 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51899-NF
    TSPAN31 cDNA ORF Clone, Mouse, C-His tag MG51899-CH
    TSPAN31 cDNA ORF Clone, Mouse, N-His tag MG51899-NH
    TSPAN31 cDNA ORF Clone, Mouse, C-HA tag MG51899-CY
    TSPAN31 cDNA ORF Clone, Mouse, N-HA tag MG51899-NY
    TSPAN31 cDNA ORF Clone, Mouse, C-Myc tag MG51899-CM
    TSPAN31 cDNA ORF Clone, Mouse, N-Myc tag MG51899-NM
    TSPAN31 qPCR Primer Pairs, Mouse MP201772

    TSPAN31 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TSPAN31 cDNA ORF Clone in Cloning Vector, Human HG14231-G
    TSPAN31 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14231-ACGLN
    TSPAN31 cDNA ORF Clone, Human, C-GFPSpark® tag HG14231-ACG
    TSPAN31 cDNA ORF Clone, Human, C-OFPSpark® tag HG14231-ACR
    TSPAN31 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14231-CF
    TSPAN31 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14231-NF
    TSPAN31 cDNA ORF Clone, Human, C-His tag HG14231-CH
    TSPAN31 cDNA ORF Clone, Human, N-His tag HG14231-NH
    TSPAN31 cDNA ORF Clone, Human, C-HA tag HG14231-CY
    TSPAN31 cDNA ORF Clone, Human, N-HA tag HG14231-NY
    TSPAN31 cDNA ORF Clone, Human, C-Myc tag HG14231-CM
    TSPAN31 cDNA ORF Clone, Human, N-Myc tag HG14231-NM
    TSPAN31 qPCR Primer Pairs, Human HP102881
    info info
    添加购物车成功! 添加购物车失败!