C-MPL cDNA ORF Clone, Human, C-His tag

Cat: HG10443-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All C-MPL Reagents

CRO Services

Product recommended


All C-MPL Reagents

C-MPL cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1908 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human myeloproliferative leukemia virus oncogene with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb + 0.99kb + 0.98kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C-MPL cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C-MPL cDNA ORF Clone, Human, C-His tag Validated Images

Human c-MPL / CD110 / TPOR Gene Plasmid Map 5707

C-MPL cDNA ORF Clone, Human, C-His tag Alternative Names

C-MPL cDNA ORF Clone, Human;CD110 cDNA ORF Clone, Human;MPLV cDNA ORF Clone, Human;THCYT2 cDNA ORF Clone, Human;TPOR cDNA ORF Clone, Human

C-MPL Background Information

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Full Name
MPL proto-oncogene, thrombopoietin receptor
References
  • Vigon I., et al.,(1992), Molecular cloning and characterization of MPL, the human homolog of the v-mpl oncogene: identification of a member of the hematopoietic growth factor receptor superfamily. Proc. Natl. Acad. Sci. U.S.A. 89:5640-5644.
  • Mignotte V., et al., (1994), Structure and transcription of the human c-mpl gene (MPL).Genomics 20:5-12.
  • Gregory S.G., et al.,(2006), The DNA sequence and biological annotation of human chromosome 1.Nature 441:315-321.
  • C-MPL cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    C-MPL cDNA ORF Clone in Cloning Vector, Rat RG80346-G
    C-MPL cDNA ORF Clone, Rat, untagged RG80346-UT
    C-MPL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80346-ACG
    C-MPL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80346-ACGLN
    C-MPL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80346-ACR
    C-MPL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80346-CF
    C-MPL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80346-NF
    C-MPL cDNA ORF Clone, Rat, C-His tag RG80346-CH
    C-MPL cDNA ORF Clone, Rat, N-His tag RG80346-NH
    C-MPL cDNA ORF Clone, Rat, C-HA tag RG80346-CY
    C-MPL cDNA ORF Clone, Rat, N-HA tag RG80346-NY
    C-MPL cDNA ORF Clone, Rat, C-Myc tag RG80346-CM
    C-MPL cDNA ORF Clone, Rat, N-Myc tag RG80346-NM
    C-MPL qPCR Primer Pairs, Rat RP300316

    C-MPL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    C-MPL cDNA ORF Clone in Cloning Vector, Mouse MG50373-M
    C-MPL cDNA ORF Clone, Mouse, untagged MG50373-UT
    C-MPL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50373-ACG
    C-MPL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50373-ACGLN
    C-MPL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50373-ACR
    C-MPL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50373-CF
    C-MPL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50373-NF
    C-MPL cDNA ORF Clone, Mouse, C-His tag MG50373-CH
    C-MPL cDNA ORF Clone, Mouse, N-His tag MG50373-NH
    C-MPL cDNA ORF Clone, Mouse, C-HA tag MG50373-CY
    C-MPL cDNA ORF Clone, Mouse, N-HA tag MG50373-NY
    C-MPL cDNA ORF Clone, Mouse, C-Myc tag MG50373-CM
    C-MPL cDNA ORF Clone, Mouse, N-Myc tag MG50373-NM
    C-MPL qPCR Primer Pairs, Mouse MP200393

    C-MPL cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    C-MPL cDNA ORF Clone in Cloning Vector, Human HG10443-M
    C-MPL cDNA ORF Clone, Human, untagged HG10443-UT
    C-MPL cDNA ORF Clone, Human, C-GFPSpark® tag HG10443-ACG
    C-MPL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10443-ACGLN
    C-MPL cDNA ORF Clone, Human, C-OFPSpark® tag HG10443-ACR
    C-MPL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10443-CF
    C-MPL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10443-NF
    C-MPL cDNA ORF Clone, Human, N-His tag HG10443-NH
    C-MPL cDNA ORF Clone, Human, C-HA tag HG10443-CY
    C-MPL cDNA ORF Clone, Human, N-HA tag HG10443-NY
    C-MPL cDNA ORF Clone, Human, C-Myc tag HG10443-CM
    C-MPL cDNA ORF Clone, Human, N-Myc tag HG10443-NM
    C-MPL qPCR Primer Pairs, Human HP100472
    info info
    添加购物车成功! 添加购物车失败!