Thimet Oligopeptidase cDNA ORF Clone, Human, N-HA tag

Cat: HG10512-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Thimet Oligopeptidase Reagents
CRO Services
Product recommended

All Thimet Oligopeptidase Reagents
Thimet Oligopeptidase cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2070 bp
Description
Full length Clone DNA of Human thimet oligopeptidase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thimet Oligopeptidase cDNA ORF Clone, Human, N-HA tag Alternative Names
EP24.15 cDNA ORF Clone, Human;MEPD_HUMAN cDNA ORF Clone, Human;MP78 cDNA ORF Clone, Human;TOP cDNA ORF Clone, Human
Thimet Oligopeptidase Background Information

THOP1, also known as Thimet oligopeptidase 1, Thimet oligopeptidase, EC 3.4.24.15, or EP24.15, is a zinc(II) endopeptidase implicated in the processing of numerous physiological peptides. As an intracellular enzyme, highly expressed in the brain, kidneys and neuroendocrine tissue, THOP1 has been proposed to metabolize peptides within cells, thereby affecting antigen presentation and G protein-coupled receptor signal transduction. Its substrates is gonadotrophin-releasing hormone (GnRH), an important hypothalamic hormone that regulates the synthesis and release of oestradiol and facilitates female sexual behaviour. THOP1 against toxic effects of Abeta in the early stages of Alzheimer disease (AD) pathology, and suggest that the observed increase in THOP1 expression might be part of a compensatory defense mechanism of the brain against an increased Abeta load.

Full Name
thimet oligopeptidase 1
References
  • Cyr NE, et al. (2010) Nuclear Thimet oligopeptidase is coexpressed with oestrogen receptor alpha in hypothalamic cells and regulated by oestradiol in female mice. J Neuroendocrinol. 22(8): 936-43.
  • Berti DA, et al. (2009) Analysis of intracellular substrates and products of thimet oligopeptidase in human embryonic kidney 293 cells. J Biol Chem. 284(21): 14105-16.
  • Russo LC, et al. (2009) Interaction with calmodulin is important for the secretion of thimet oligopeptidase following stimulation. FEBS J. 276(16): 4358-71.
  • Pollio G, et al. (2008) Increased expression of the oligopeptidase THOP1 is a neuroprotective response to Abeta toxicity. Neurobiol Dis. 31(1): 145-58.
  • Bruce LA, et al. (2008) Hydrogen bond residue positioning in the 599-611 loop of thimet oligopeptidase is required for substrate selection. FEBS J. 275(22): 5607-17.
  • Thimet Oligopeptidase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thimet Oligopeptidase cDNA ORF Clone in Cloning Vector, Mouse MG50828-G
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, untagged MG50828-UT
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50828-ACG
    Thimet Oligopeptidase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50828-ACGLN
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50828-ANG
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50828-ACR
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50828-ANR
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50828-CF
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50828-NF
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-His tag MG50828-CH
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-His tag MG50828-NH
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-HA tag MG50828-CY
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-HA tag MG50828-NY
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, C-Myc tag MG50828-CM
    Thimet Oligopeptidase cDNA ORF Clone, Mouse, N-Myc tag MG50828-NM
    Thimet Oligopeptidase qPCR Primer Pairs, Mouse MP200799

    Thimet Oligopeptidase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thimet Oligopeptidase cDNA ORF Clone in Cloning Vector, Human HG10512-M
    Thimet Oligopeptidase cDNA ORF Clone, Human, untagged HG10512-UT
    Thimet Oligopeptidase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10512-ACGLN
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-GFPSpark® tag HG10512-ACG
    Thimet Oligopeptidase cDNA ORF Clone, Human, N-GFPSpark® tag HG10512-ANG
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-OFPSpark® tag HG10512-ACR
    Thimet Oligopeptidase cDNA ORF Clone, Human, N-OFPSpark® tag HG10512-ANR
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10512-CF
    Thimet Oligopeptidase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10512-NF
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-His tag HG10512-CH
    Thimet Oligopeptidase cDNA ORF Clone, Human, N-His tag HG10512-NH
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-HA tag HG10512-CY
    Thimet Oligopeptidase cDNA ORF Clone, Human, C-Myc tag HG10512-CM
    Thimet Oligopeptidase cDNA ORF Clone, Human, N-Myc tag HG10512-NM
    Thimet Oligopeptidase qPCR Primer Pairs, Human HP100532
    info info
    添加购物车成功! 添加购物车失败!