Transferrin Receptor / TFRC cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/2
Price:
Size:
Number:

Transferrin Receptor / TFRC cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2283 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human transferrin receptor (p90, CD71) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII (two restriction sites) + XbaI (5.99kb + 1.47kb + 0.91kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Transferrin Receptor / TFRC cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transferrin Receptor / TFRC cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Transferrin Receptor / TFRC cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CD71 cDNA ORF Clone, Human; p90 cDNA ORF Clone, Human; T9 cDNA ORF Clone, Human; TFR cDNA ORF Clone, Human; TFR1 cDNA ORF Clone, Human; TR cDNA ORF Clone, Human; TRFR cDNA ORF Clone, Human

Transferrin Receptor / TFRC Background Information

Transferrin receptor protein 1, also known as transferrin receptor, Trfr, p9, CD71 and TFRC, is a single-pass type II membrane protein which belongs to thepeptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.
Full Name
transferrin receptor
References
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait