Tapasin cDNA ORF Clone, Human, N-Myc tag

Cat: HG15478-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Tapasin Reagents
CRO Services
Product recommended

All Tapasin Reagents
Tapasin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Human TAP binding protein (tapasin) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tapasin cDNA ORF Clone, Human, N-Myc tag Alternative Names
NGS17 cDNA ORF Clone, Human;TAPA cDNA ORF Clone, Human;TPN cDNA ORF Clone, Human;TPSN cDNA ORF Clone, Human
Tapasin Background Information
Full Name
TAP binding protein (tapasin)

Tapasin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Tapasin cDNA ORF Clone in Cloning Vector, Mouse MG58248-U
Tapasin cDNA ORF Clone, Mouse, untagged MG58248-UT
Tapasin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58248-ACGLN
Tapasin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58248-ACG
Tapasin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58248-ACR
Tapasin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58248-CF
Tapasin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58248-NF
Tapasin cDNA ORF Clone, Mouse, C-His tag MG58248-CH
Tapasin cDNA ORF Clone, Mouse, N-His tag MG58248-NH
Tapasin cDNA ORF Clone, Mouse, C-HA tag MG58248-CY
Tapasin cDNA ORF Clone, Mouse, N-HA tag MG58248-NY
Tapasin cDNA ORF Clone, Mouse, C-Myc tag MG58248-CM
Tapasin cDNA ORF Clone, Mouse, N-Myc tag MG58248-NM

Tapasin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Tapasin cDNA ORF Clone in Cloning Vector, Human HG15478-G
Tapasin cDNA ORF Clone, Human, untagged HG15478-UT
Tapasin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15478-ACGLN
Tapasin cDNA ORF Clone, Human, C-GFPSpark® tag HG15478-ACG
Tapasin cDNA ORF Clone, Human, C-OFPSpark® tag HG15478-ACR
Tapasin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15478-CF
Tapasin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15478-NF
Tapasin cDNA ORF Clone, Human, C-His tag HG15478-CH
Tapasin cDNA ORF Clone, Human, N-His tag HG15478-NH
Tapasin cDNA ORF Clone, Human, C-HA tag HG15478-CY
Tapasin cDNA ORF Clone, Human, N-HA tag HG15478-NY
Tapasin cDNA ORF Clone, Human, C-Myc tag HG15478-CM
Tapasin qPCR Primer Pairs, Human HP104100
info info
添加购物车成功! 添加购物车失败!