TAF7 cDNA ORF Clone, Human, N-HA tag

Cat: HG16413-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TAF7 Reagents
CRO Services
Product recommended

All TAF7 Reagents
TAF7 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Human TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAF7 cDNA ORF Clone, Human, N-HA tag Alternative Names
TAF2F cDNA ORF Clone, Human;TAFII55 cDNA ORF Clone, Human
TAF7 Background Information
Full Name
TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa

TAF7 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TAF7 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90338-G
TAF7 cDNA ORF Clone, Cynomolgus, untagged CG90338-UT
TAF7 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90338-ACGLN
TAF7 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90338-ACG
TAF7 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90338-ANG
TAF7 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90338-ACR
TAF7 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90338-ANR
TAF7 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90338-CF
TAF7 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90338-NF
TAF7 cDNA ORF Clone, Cynomolgus, C-His tag CG90338-CH
TAF7 cDNA ORF Clone, Cynomolgus, N-His tag CG90338-NH
TAF7 cDNA ORF Clone, Cynomolgus, C-HA tag CG90338-CY
TAF7 cDNA ORF Clone, Cynomolgus, N-HA tag CG90338-NY
TAF7 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90338-CM
TAF7 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90338-NM

TAF7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TAF7 cDNA ORF Clone in Cloning Vector, Mouse MG5A0677-U
TAF7 cDNA ORF Clone, Mouse, untagged MG5A0677-UT
TAF7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0677-ACG
TAF7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0677-ACGLN
TAF7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0677-ANG
TAF7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0677-ACR
TAF7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0677-ANR
TAF7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0677-CF
TAF7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0677-NF
TAF7 cDNA ORF Clone, Mouse, C-His tag MG5A0677-CH
TAF7 cDNA ORF Clone, Mouse, N-His tag MG5A0677-NH
TAF7 cDNA ORF Clone, Mouse, C-HA tag MG5A0677-CY
TAF7 cDNA ORF Clone, Mouse, N-HA tag MG5A0677-NY
TAF7 cDNA ORF Clone, Mouse, C-Myc tag MG5A0677-CM
TAF7 cDNA ORF Clone, Mouse, N-Myc tag MG5A0677-NM

TAF7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAF7 cDNA ORF Clone in Cloning Vector, Human HG16413-G
TAF7 cDNA ORF Clone, Human, untagged HG16413-UT
TAF7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16413-ACG
TAF7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16413-ACGLN
TAF7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16413-ANG
TAF7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16413-ACR
TAF7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16413-ANR
TAF7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16413-CF
TAF7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16413-NF
TAF7 cDNA ORF Clone, Human, C-His tag HG16413-CH
TAF7 cDNA ORF Clone, Human, N-His tag HG16413-NH
TAF7 cDNA ORF Clone, Human, C-HA tag HG16413-CY
TAF7 cDNA ORF Clone, Human, C-Myc tag HG16413-CM
TAF7 cDNA ORF Clone, Human, N-Myc tag HG16413-NM
TAF7 qPCR Primer Pairs, Human HP105162
info info
添加购物车成功! 添加购物车失败!