STAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10547-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STAT2 Reagents

CRO Services

Product recommended


All STAT2 Reagents

STAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2595 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human signal transducer and activator of transcription 2, 113kDa with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.6kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

STAT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human aFGF/FGF1 Gene Plasmid Map 5637

STAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

ISGF-3 cDNA ORF Clone, Human;P113 cDNA ORF Clone, Human;STAT113 cDNA ORF Clone, Human

STAT2 Background Information

Full Name
signal transducer and activator of transcription 2, 113kDa

STAT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STAT2 cDNA ORF Clone in Cloning Vector, Rat RG80596-U
STAT2 cDNA ORF Clone, Rat, untagged RG80596-UT
STAT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80596-ACG
STAT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80596-ACGLN
STAT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80596-ANG
STAT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80596-ACR
STAT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80596-ANR
STAT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80596-CF
STAT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80596-NF
STAT2 cDNA ORF Clone, Rat, C-His tag RG80596-CH
STAT2 cDNA ORF Clone, Rat, N-His tag RG80596-NH
STAT2 cDNA ORF Clone, Rat, C-HA tag RG80596-CY
STAT2 cDNA ORF Clone, Rat, N-HA tag RG80596-NY
STAT2 cDNA ORF Clone, Rat, C-Myc tag RG80596-CM
STAT2 cDNA ORF Clone, Rat, N-Myc tag RG80596-NM
STAT2 qPCR Primer Pairs, Rat RP300560

STAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAT2 cDNA ORF Clone in Cloning Vector, Human HG10547-M
STAT2 cDNA ORF Clone, Human, untagged HG10547-UT
STAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10547-ACGLN
STAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10547-ACG
STAT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10547-ANG
STAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10547-ACR
STAT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10547-ANR
STAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10547-CF
STAT2 cDNA ORF Clone, Human, C-His tag HG10547-CH
STAT2 cDNA ORF Clone, Human, N-His tag HG10547-NH
STAT2 cDNA ORF Clone, Human, C-HA tag HG10547-CY
STAT2 cDNA ORF Clone, Human, N-HA tag HG10547-NY
STAT2 cDNA ORF Clone, Human, C-Myc tag HG10547-CM
STAT2 cDNA ORF Clone, Human, N-Myc tag HG10547-NM
STAT2 qPCR Primer Pairs, Human HP100563
info info
添加购物车成功! 添加购物车失败!