SRM cDNA ORF Clone, Human, N-His tag

Cat: HG14261-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SRM Reagents

CRO Services

Product recommended


All SRM Reagents

SRM cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
909 bp
Description
Full length Clone DNA of Human spermidine synthase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRM cDNA ORF Clone, Human, N-His tag Alternative Names

PAPT cDNA ORF Clone, Human;SPDSY cDNA ORF Clone, Human;SPS1 cDNA ORF Clone, Human;SRML1 cDNA ORF Clone, Human

SRM Background Information

Full Name
spermidine synthase

SRM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRM cDNA ORF Clone in Cloning Vector, Mouse MG52162-G
SRM cDNA ORF Clone, Mouse, untagged MG52162-UT
SRM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52162-ACGLN
SRM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52162-ACG
SRM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52162-ANG
SRM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52162-ACR
SRM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52162-ANR
SRM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52162-CF
SRM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52162-NF
SRM cDNA ORF Clone, Mouse, C-His tag MG52162-CH
SRM cDNA ORF Clone, Mouse, N-His tag MG52162-NH
SRM cDNA ORF Clone, Mouse, C-HA tag MG52162-CY
SRM cDNA ORF Clone, Mouse, N-HA tag MG52162-NY
SRM cDNA ORF Clone, Mouse, C-Myc tag MG52162-CM
SRM cDNA ORF Clone, Mouse, N-Myc tag MG52162-NM
SRM qPCR Primer Pairs, Mouse MP202035

SRM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRM cDNA ORF Clone in Cloning Vector, Human HG14261-G
SRM cDNA ORF Clone, Human, untagged HG14261-UT
SRM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14261-ACGLN
SRM cDNA ORF Clone, Human, C-GFPSpark® tag HG14261-ACG
SRM cDNA ORF Clone, Human, N-GFPSpark® tag HG14261-ANG
SRM cDNA ORF Clone, Human, C-OFPSpark® tag HG14261-ACR
SRM cDNA ORF Clone, Human, N-OFPSpark® tag HG14261-ANR
SRM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14261-CF
SRM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14261-NF
SRM cDNA ORF Clone, Human, C-His tag HG14261-CH
SRM cDNA ORF Clone, Human, C-HA tag HG14261-CY
SRM cDNA ORF Clone, Human, N-HA tag HG14261-NY
SRM cDNA ORF Clone, Human, C-Myc tag HG14261-CM
SRM cDNA ORF Clone, Human, N-Myc tag HG14261-NM
SRM qPCR Primer Pairs, Human HP102911
info info
添加购物车成功! 添加购物车失败!