SNX17 cDNA ORF Clone, Human, N-His tag

Cat: HG14841-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SNX17 Reagents

CRO Services

Product recommended


All SNX17 Reagents

SNX17 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Human sorting nexin 17 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX17 Background Information

Full Name
sorting nexin 17

SNX17 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SNX17 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90386-G
SNX17 cDNA ORF Clone, Cynomolgus, untagged CG90386-UT
SNX17 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90386-ACG
SNX17 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90386-ACGLN
SNX17 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90386-ANG
SNX17 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90386-ACR
SNX17 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90386-ANR
SNX17 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90386-CF
SNX17 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90386-NF
SNX17 cDNA ORF Clone, Cynomolgus, C-His tag CG90386-CH
SNX17 cDNA ORF Clone, Cynomolgus, N-His tag CG90386-NH
SNX17 cDNA ORF Clone, Cynomolgus, C-HA tag CG90386-CY
SNX17 cDNA ORF Clone, Cynomolgus, N-HA tag CG90386-NY
SNX17 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90386-CM
SNX17 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90386-NM

SNX17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX17 cDNA ORF Clone in Cloning Vector, Mouse MG52879-G
SNX17 cDNA ORF Clone, Mouse, untagged MG52879-UT
SNX17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52879-ACG
SNX17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52879-ACGLN
SNX17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52879-ANG
SNX17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52879-ACR
SNX17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52879-ANR
SNX17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52879-CF
SNX17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52879-NF
SNX17 cDNA ORF Clone, Mouse, C-His tag MG52879-CH
SNX17 cDNA ORF Clone, Mouse, N-His tag MG52879-NH
SNX17 cDNA ORF Clone, Mouse, C-HA tag MG52879-CY
SNX17 cDNA ORF Clone, Mouse, N-HA tag MG52879-NY
SNX17 cDNA ORF Clone, Mouse, C-Myc tag MG52879-CM
SNX17 cDNA ORF Clone, Mouse, N-Myc tag MG52879-NM

SNX17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX17 cDNA ORF Clone in Cloning Vector, Human HG14841-G
SNX17 cDNA ORF Clone, Human, untagged HG14841-UT
SNX17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14841-ACGLN
SNX17 cDNA ORF Clone, Human, C-GFPSpark® tag HG14841-ACG
SNX17 cDNA ORF Clone, Human, N-GFPSpark® tag HG14841-ANG
SNX17 cDNA ORF Clone, Human, C-OFPSpark® tag HG14841-ACR
SNX17 cDNA ORF Clone, Human, N-OFPSpark® tag HG14841-ANR
SNX17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14841-CF
SNX17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14841-NF
SNX17 cDNA ORF Clone, Human, C-His tag HG14841-CH
SNX17 cDNA ORF Clone, Human, C-HA tag HG14841-CY
SNX17 cDNA ORF Clone, Human, N-HA tag HG14841-NY
SNX17 cDNA ORF Clone, Human, C-Myc tag HG14841-CM
SNX17 cDNA ORF Clone, Human, N-Myc tag HG14841-NM
SNX17 qPCR Primer Pairs, Human HP103472
info info
添加购物车成功! 添加购物车失败!