SMOC1 cDNA ORF Clone, Human, untagged

Cat: HG12026-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SMOC1 Reagents
CRO Services
Product recommended

All SMOC1 Reagents
SMOC1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 126G/A,702C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human SPARC related modular calcium binding 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6kb+1.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SMOC1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMOC1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
SMOC1 cDNA ORF Clone, Human, untagged Alternative Names
OAS cDNA ORF Clone, Human
SMOC1 Background Information

SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.

Full Name
SPARC related modular calcium binding 1
References
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • info info
    添加购物车成功! 添加购物车失败!