SLITRK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10340-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SLITRK1 Reagents

CRO Services

Product recommended


All SLITRK1 Reagents

SLITRK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2091 bp
Description
Full length Clone DNA of Human SLIT and NTRK-like family, member 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLITRK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

FLJ54428 cDNA ORF Clone, Human;KIAA0918 cDNA ORF Clone, Human;KIAA1910 cDNA ORF Clone, Human;LRRC12 cDNA ORF Clone, Human;RP11-395N17.1 cDNA ORF Clone, Human;SLITRK1 cDNA ORF Clone, Human;TTM cDNA ORF Clone, Human

SLITRK1 Background Information

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.

Full Name
SLIT and NTRK like family member 1
References

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

SLITRK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLITRK1 cDNA ORF Clone in Cloning Vector, Mouse MG50382-M
SLITRK1 cDNA ORF Clone, Mouse, untagged MG50382-UT
SLITRK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50382-ACG
SLITRK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50382-ACGLN
SLITRK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50382-ACR
SLITRK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50382-CF
SLITRK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50382-NF
SLITRK1 cDNA ORF Clone, Mouse, C-His tag MG50382-CH
SLITRK1 cDNA ORF Clone, Mouse, N-His tag MG50382-NH
SLITRK1 cDNA ORF Clone, Mouse, C-HA tag MG50382-CY
SLITRK1 cDNA ORF Clone, Mouse, N-HA tag MG50382-NY
SLITRK1 cDNA ORF Clone, Mouse, C-Myc tag MG50382-CM
SLITRK1 cDNA ORF Clone, Mouse, N-Myc tag MG50382-NM
SLITRK1 qPCR Primer Pairs, Mouse MP200403

SLITRK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLITRK1 cDNA ORF Clone in Cloning Vector, Human HG10340-M
SLITRK1 cDNA ORF Clone, Human, untagged HG10340-UT
SLITRK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10340-ACGLN
SLITRK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10340-ACG
SLITRK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10340-ACR
SLITRK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10340-NF
SLITRK1 cDNA ORF Clone, Human, C-His tag HG10340-CH
SLITRK1 cDNA ORF Clone, Human, N-His tag HG10340-NH
SLITRK1 cDNA ORF Clone, Human, C-HA tag HG10340-CY
SLITRK1 cDNA ORF Clone, Human, N-HA tag HG10340-NY
SLITRK1 cDNA ORF Clone, Human, C-Myc tag HG10340-CM
SLITRK1 cDNA ORF Clone, Human, N-Myc tag HG10340-NM
SLITRK1 qPCR Primer Pairs, Human HP100378
info info
添加购物车成功! 添加购物车失败!