Neuroserpin cDNA ORF Clone, Human, C-His tag

Cat: HG11107-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Neuroserpin Reagents

CRO Services

Product recommended


All Neuroserpin Reagents

Neuroserpin cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neuroserpin cDNA ORF Clone, Human, C-His tag Alternative Names

neuroserpin cDNA ORF Clone, Human;PI12 cDNA ORF Clone, Human

Neuroserpin Background Information

Neuroserpin, also known as Protease inhibitor 12 and SERPINI1, is a secreted protein which belongs to the serpin family. Neuroserpin is a serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. Neuroserpin is predominantly expressed in the brain, and is expressed in the late stages of neurogenesis during the process of synapse formation. Overexpression of neuroserpin in an anterior pituitary corticotroph cell line results in the extension of neurite-like processes, suggesting that neuroserpin may play a role in cell communication, cell adhesion, and/or cell migration. Neuroserpin may be involved in the formation or reorganization of synaptic connections, as well as synaptic plasticity in the adult nervous system. Neuroserpin may also protect neurons from cell damage by tissue-type plasminogen activator. Defects of neuroserpin are the cause of familial encephalopathy with neuroserpin inclusion bodies (FEN1B).

Full Name
serpin peptidase inhibitor, clade I (neuroserpin), member 1
References
  • Schrimpf SP. et al., 1997, Genomics. 40 (1): 55-62.
  • Hill RM. et al., 2002, Ann N Y Acad Sci. 971: 406-15.
  • Yepes M. et al., 2004, Thromb. Haemost. 91 (3): 457-64.
  • Galliciotti G. et al., 2006, Front Biosci. 11: 33-45.
  • Neuroserpin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Neuroserpin cDNA ORF Clone in Cloning Vector, Mouse MG50926-G
    Neuroserpin cDNA ORF Clone, Mouse, untagged MG50926-UT
    Neuroserpin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50926-ACGLN
    Neuroserpin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50926-ACG
    Neuroserpin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50926-ACR
    Neuroserpin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50926-CF
    Neuroserpin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50926-NF
    Neuroserpin cDNA ORF Clone, Mouse, C-His tag MG50926-CH
    Neuroserpin cDNA ORF Clone, Mouse, N-His tag MG50926-NH
    Neuroserpin cDNA ORF Clone, Mouse, C-HA tag MG50926-CY
    Neuroserpin cDNA ORF Clone, Mouse, N-HA tag MG50926-NY
    Neuroserpin cDNA ORF Clone, Mouse, C-Myc tag MG50926-CM
    Neuroserpin cDNA ORF Clone, Mouse, N-Myc tag MG50926-NM
    Neuroserpin qPCR Primer Pairs, Mouse MP200895

    Neuroserpin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Neuroserpin cDNA ORF Clone in Cloning Vector, Human HG11107-M
    Neuroserpin cDNA ORF Clone, Human, untagged HG11107-UT
    Neuroserpin cDNA ORF Clone, Human, C-GFPSpark® tag HG11107-ACG
    Neuroserpin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11107-ACGLN
    Neuroserpin cDNA ORF Clone, Human, C-OFPSpark® tag HG11107-ACR
    Neuroserpin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11107-CF
    Neuroserpin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11107-NF
    Neuroserpin cDNA ORF Clone, Human, N-His tag HG11107-NH
    Neuroserpin cDNA ORF Clone, Human, C-HA tag HG11107-CY
    Neuroserpin cDNA ORF Clone, Human, N-HA tag HG11107-NY
    Neuroserpin cDNA ORF Clone, Human, C-Myc tag HG11107-CM
    Neuroserpin cDNA ORF Clone, Human, N-Myc tag HG11107-NM
    Neuroserpin qPCR Primer Pairs, Human HP101022
    info info
    添加购物车成功! 添加购物车失败!