Psoriasin cDNA ORF Clone, Human, C-HA tag

Cat: HG11141-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Psoriasin Reagents

CRO Services

Product recommended


All Psoriasin Reagents

Psoriasin cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
348 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A7 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.35kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Psoriasin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Psoriasin cDNA ORF Clone, Human, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

Psoriasin cDNA ORF Clone, Human, C-HA tag Alternative Names

PSOR1 cDNA ORF Clone, Human;S100A7c cDNA ORF Clone, Human

Psoriasin Background Information

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

Full Name
S100 calcium binding protein A7
References
  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • info info
    添加购物车成功! 添加购物车失败!