RGS2 cDNA ORF Clone, Human, C-His tag

Cat: HG14010-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RGS2 Reagents
CRO Services
Product recommended

All RGS2 Reagents
RGS2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
636 bp
Description
Full length Clone DNA of Human regulator of G-protein signaling 2, 24kDA with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RGS2 cDNA ORF Clone, Human, C-His tag Alternative Names
G0S8 cDNA ORF Clone, Human
RGS2 Background Information
Full Name
regulator of G-protein signaling 2

RGS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RGS2 cDNA ORF Clone in Cloning Vector, Mouse MG51510-U
RGS2 cDNA ORF Clone, Mouse, untagged MG51510-UT
RGS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51510-ACGLN
RGS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51510-ACG
RGS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51510-ANG
RGS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51510-ACR
RGS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51510-ANR
RGS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51510-CF
RGS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51510-NF
RGS2 cDNA ORF Clone, Mouse, C-His tag MG51510-CH
RGS2 cDNA ORF Clone, Mouse, N-His tag MG51510-NH
RGS2 cDNA ORF Clone, Mouse, C-HA tag MG51510-CY
RGS2 cDNA ORF Clone, Mouse, N-HA tag MG51510-NY
RGS2 cDNA ORF Clone, Mouse, C-Myc tag MG51510-CM
RGS2 cDNA ORF Clone, Mouse, N-Myc tag MG51510-NM
RGS2 qPCR Primer Pairs, Mouse MP201394

RGS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RGS2 cDNA ORF Clone in Cloning Vector, Human HG14010-G
RGS2 cDNA ORF Clone, Human, untagged HG14010-UT
RGS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14010-ACGLN
RGS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14010-ACG
RGS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14010-ANG
RGS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14010-ACR
RGS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14010-ANR
RGS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14010-CF
RGS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14010-NF
RGS2 cDNA ORF Clone, Human, N-His tag HG14010-NH
RGS2 cDNA ORF Clone, Human, C-HA tag HG14010-CY
RGS2 cDNA ORF Clone, Human, N-HA tag HG14010-NY
RGS2 cDNA ORF Clone, Human, C-Myc tag HG14010-CM
RGS2 cDNA ORF Clone, Human, N-Myc tag HG14010-NM
RGS2 qPCR Primer Pairs, Human HP102666
info info
添加购物车成功! 添加购物车失败!