RGS16 cDNA ORF Clone, Human, C-His tag

Cat: HG14592-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RGS16 Reagents

CRO Services

Product recommended


All RGS16 Reagents

RGS16 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Human regulator of G-protein signaling 16 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RGS16 cDNA ORF Clone, Human, C-His tag Alternative Names

A28-RGS14 cDNA ORF Clone, Human;A28-RGS14P cDNA ORF Clone, Human;RGS-R cDNA ORF Clone, Human

RGS16 Background Information

Full Name
regulator of G-protein signaling 16

RGS16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RGS16 cDNA ORF Clone in Cloning Vector, Mouse MG52323-G
RGS16 cDNA ORF Clone, Mouse, untagged MG52323-UT
RGS16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52323-ACGLN
RGS16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52323-ACG
RGS16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52323-ANG
RGS16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52323-ACR
RGS16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52323-ANR
RGS16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52323-CF
RGS16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52323-NF
RGS16 cDNA ORF Clone, Mouse, C-His tag MG52323-CH
RGS16 cDNA ORF Clone, Mouse, N-His tag MG52323-NH
RGS16 cDNA ORF Clone, Mouse, C-HA tag MG52323-CY
RGS16 cDNA ORF Clone, Mouse, N-HA tag MG52323-NY
RGS16 cDNA ORF Clone, Mouse, C-Myc tag MG52323-CM
RGS16 cDNA ORF Clone, Mouse, N-Myc tag MG52323-NM
RGS16 qPCR Primer Pairs, Mouse MP202196

RGS16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RGS16 cDNA ORF Clone in Cloning Vector, Human HG14592-G
RGS16 cDNA ORF Clone, Human, untagged HG14592-UT
RGS16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14592-ACGLN
RGS16 cDNA ORF Clone, Human, C-GFPSpark® tag HG14592-ACG
RGS16 cDNA ORF Clone, Human, N-GFPSpark® tag HG14592-ANG
RGS16 cDNA ORF Clone, Human, C-OFPSpark® tag HG14592-ACR
RGS16 cDNA ORF Clone, Human, N-OFPSpark® tag HG14592-ANR
RGS16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14592-CF
RGS16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14592-NF
RGS16 cDNA ORF Clone, Human, N-His tag HG14592-NH
RGS16 cDNA ORF Clone, Human, C-HA tag HG14592-CY
RGS16 cDNA ORF Clone, Human, N-HA tag HG14592-NY
RGS16 cDNA ORF Clone, Human, C-Myc tag HG14592-CM
RGS16 cDNA ORF Clone, Human, N-Myc tag HG14592-NM
RGS16 qPCR Primer Pairs, Human HP103226
info info
添加购物车成功! 添加购物车失败!