RCHY1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15121-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RCHY1 Reagents

CRO Services

Product recommended


All RCHY1 Reagents

RCHY1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RCHY1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

ARNIP cDNA ORF Clone, Human;CHIMP cDNA ORF Clone, Human;PIRH2 cDNA ORF Clone, Human;PRO1996 cDNA ORF Clone, Human;RNF199 cDNA ORF Clone, Human;ZCHY cDNA ORF Clone, Human;ZNF363 cDNA ORF Clone, Human

RCHY1 Background Information

Full Name
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase

RCHY1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RCHY1 cDNA ORF Clone in Cloning Vector, Rat RG85125-U
RCHY1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85125-ACGLN

RCHY1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RCHY1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0567-U
RCHY1 cDNA ORF Clone, Mouse, untagged MG5A0567-UT
RCHY1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0567-ACGLN
RCHY1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0567-ACG
RCHY1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0567-ANG
RCHY1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0567-ACR
RCHY1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0567-ANR
RCHY1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0567-CF
RCHY1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0567-NF
RCHY1 cDNA ORF Clone, Mouse, C-His tag MG5A0567-CH
RCHY1 cDNA ORF Clone, Mouse, N-His tag MG5A0567-NH
RCHY1 cDNA ORF Clone, Mouse, C-HA tag MG5A0567-CY
RCHY1 cDNA ORF Clone, Mouse, N-HA tag MG5A0567-NY
RCHY1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0567-CM
RCHY1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0567-NM

RCHY1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RCHY1 cDNA ORF Clone in Cloning Vector, Human HG15121-G
RCHY1 cDNA ORF Clone, Human, untagged HG15121-UT
RCHY1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15121-ACG
RCHY1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15121-ACGLN
RCHY1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15121-ANG
RCHY1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15121-ACR
RCHY1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15121-ANR
RCHY1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15121-CF
RCHY1 cDNA ORF Clone, Human, C-His tag HG15121-CH
RCHY1 cDNA ORF Clone, Human, N-His tag HG15121-NH
RCHY1 cDNA ORF Clone, Human, C-HA tag HG15121-CY
RCHY1 cDNA ORF Clone, Human, N-HA tag HG15121-NY
RCHY1 cDNA ORF Clone, Human, C-Myc tag HG15121-CM
RCHY1 cDNA ORF Clone, Human, N-Myc tag HG15121-NM
RCHY1 qPCR Primer Pairs, Human HP103748
info info
添加购物车成功! 添加购物车失败!