Pentraxin 3 cDNA ORF Clone, Human, C-HA tag

Cat: HG12082-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Pentraxin 3 Reagents
CRO Services
Product recommended

All Pentraxin 3 Reagents
Pentraxin 3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1188 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pentraxin-related gene, rapidly induced by IL-1 betaV with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.19kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Pentraxin 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Pentraxin 3 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Pentraxin 3 cDNA ORF Clone, Human, C-HA tag Alternative Names
PTX3 cDNA ORF Clone, Human;TNFAIP5 cDNA ORF Clone, Human;TSG-14 cDNA ORF Clone, Human
Pentraxin 3 Background Information

Pentraxin-related protein PTX3, also known as Tumor necrosis factor alpha-induced protein 5, Tumor necrosis factor-inducible gene 14 protein, TSG-14, PTX3 and TNFAIP5, is a secreted protein which contains one pentaxin domain. PTX3 plays a role in the regulation of innate resistance to pathogens, inflammatory reactions, possibly clearance of self-components and female fertility. Pentraxins are a family of evolutionarily conserved multifunctional pattern-recognition proteins characterized by a cyclic multimeric structure. Based on the primary structure of the subunit, the pentraxins are divided into two groups: short pentraxins and long pentraxins. C-reactive protein (CRP) and serum amyloid P-component (SAP) are the two short pentraxins. The prototype protein of the long pentraxin group is pentraxin 3 (PTX3). CRP and SAP are produced primarily in the liver in response to IL-6, while PTX3 is produced by a variety of tissues and cells and in particular by innate immunity cells in response to proinflammatory signals and Toll-like receptor (TLR) engagement. PTX3 is essential in female fertility by acting as a nodal point for the assembly of the cumulus oophorus hyaluronan-rich extracellular matrix. PTX3 interacts with several ligands, including growth factors, extracellular matrix components and selected pathogens, playing a role in complement activation and facilitating pathogen recognition by phagocytes, acting as a predecessor of antibodies. PTX3 may also contribute to the pathogenesis of atherosclerosis.

Full Name
pentraxin 3
References
  • Rolph,M.S. et al., 2002, Arterioscler Thromb Vasc Biol. 22 (5):e10-4.
  • Mantovani A., et al., 2003, Vaccine. 21:S43-S47.
  • Luchetti,M.M. et al., 2004, Clin Exp Rheumatol. 22 (3):S66-72.
  • Mantovani, A. et al., 2006, Vascul Pharmacol. 45 (5):326-30.
  • Inforzato A., et al., 2008, J. Biol. Chem. 283:10147-61.
  • info info
    添加购物车成功! 添加购物车失败!