PTTG1 cDNA ORF Clone, Human, C-HA tag

Cat: HG16378-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PTTG1 Reagents

CRO Services

Product recommended


All PTTG1 Reagents

PTTG1 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human pituitary tumor-transforming 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTTG1 cDNA ORF Clone, Human, C-HA tag Alternative Names

EAP1 cDNA ORF Clone, Human;HPTTG cDNA ORF Clone, Human;PTTG cDNA ORF Clone, Human;TUTR1 cDNA ORF Clone, Human

PTTG1 Background Information

Full Name
pituitary tumor-transforming 1

PTTG1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Rat RG81566-G

PTTG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Mouse MG58048-U
PTTG1 cDNA ORF Clone, Mouse, untagged MG58048-UT
PTTG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58048-ACGLN
PTTG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58048-ACG
PTTG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58048-ANG
PTTG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58048-ACR
PTTG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58048-ANR
PTTG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58048-CF
PTTG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58048-NF
PTTG1 cDNA ORF Clone, Mouse, C-His tag MG58048-CH
PTTG1 cDNA ORF Clone, Mouse, N-His tag MG58048-NH
PTTG1 cDNA ORF Clone, Mouse, C-HA tag MG58048-CY
PTTG1 cDNA ORF Clone, Mouse, N-HA tag MG58048-NY
PTTG1 cDNA ORF Clone, Mouse, C-Myc tag MG58048-CM
PTTG1 cDNA ORF Clone, Mouse, N-Myc tag MG58048-NM

PTTG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Human HG16378-G
PTTG1 cDNA ORF Clone, Human, untagged HG16378-UT
PTTG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16378-ACG
PTTG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16378-ACGLN
PTTG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16378-ANG
PTTG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16378-ACR
PTTG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16378-ANR
PTTG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16378-CF
PTTG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16378-NF
PTTG1 cDNA ORF Clone, Human, C-His tag HG16378-CH
PTTG1 cDNA ORF Clone, Human, N-His tag HG16378-NH
PTTG1 cDNA ORF Clone, Human, N-HA tag HG16378-NY
PTTG1 cDNA ORF Clone, Human, C-Myc tag HG16378-CM
PTTG1 cDNA ORF Clone, Human, N-Myc tag HG16378-NM
PTTG1 qPCR Primer Pairs, Human HP105128
info info
添加购物车成功! 添加购物车失败!