TCPTP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10570-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TCPTP Reagents
CRO Services
Product recommended

All TCPTP Reagents
TCPTP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + NotI (6kb + 1.29kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TCPTP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCPTP cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human GAPDH Gene Plasmid Map 5659
TCPTP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
PTN2 cDNA ORF Clone, Human;PTPT cDNA ORF Clone, Human;TC-PTP cDNA ORF Clone, Human;TCELLPTP cDNA ORF Clone, Human;TCPTP cDNA ORF Clone, Human
TCPTP Background Information

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Full Name
protein tyrosine phosphatase, non-receptor type 2
References
  • Cool D., et al.,(1989), cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family. Proc. Natl. Acad. Sci. U.S.A. 86:5257-5261.
  • Ota T., et al., (2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Nusbaum C., et al.,(2005), DNA sequence and analysis of human chromosome 18.Nature 437:551-555.
  • TCPTP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TCPTP cDNA ORF Clone in Cloning Vector, Rat RG81488-G

    TCPTP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TCPTP cDNA ORF Clone in Cloning Vector, Mouse MG50800-G
    TCPTP cDNA ORF Clone, Mouse, untagged MG50800-UT
    TCPTP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50800-ACGLN
    TCPTP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50800-ACG
    TCPTP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50800-ACR
    TCPTP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50800-CF
    TCPTP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50800-NF
    TCPTP cDNA ORF Clone, Mouse, C-His tag MG50800-CH
    TCPTP cDNA ORF Clone, Mouse, N-His tag MG50800-NH
    TCPTP cDNA ORF Clone, Mouse, C-HA tag MG50800-CY
    TCPTP cDNA ORF Clone, Mouse, N-HA tag MG50800-NY
    TCPTP cDNA ORF Clone, Mouse, C-Myc tag MG50800-CM
    TCPTP cDNA ORF Clone, Mouse, N-Myc tag MG50800-NM
    TCPTP qPCR Primer Pairs, Mouse MP200771

    TCPTP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TCPTP cDNA ORF Clone in Cloning Vector, Human HG10571-M
    TCPTP cDNA ORF Clone in Cloning Vector, Human HG10570-M
    TCPTP cDNA ORF Clone, Human, untagged HG10570-UT
    TCPTP cDNA ORF Clone, Human, untagged HG10571-UT
    TCPTP cDNA ORF Clone, Human, C-GFPSpark® tag HG10571-ACG
    TCPTP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10570-ACGLN
    TCPTP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10571-ACGLN
    TCPTP cDNA ORF Clone, Human, C-GFPSpark® tag HG10570-ACG
    TCPTP cDNA ORF Clone, Human, N-GFPSpark® tag HG10570-ANG
    TCPTP cDNA ORF Clone, Human, N-GFPSpark® tag HG10571-ANG
    TCPTP cDNA ORF Clone, Human, C-OFPSpark® tag HG10570-ACR
    TCPTP cDNA ORF Clone, Human, C-OFPSpark® tag HG10571-ACR
    TCPTP cDNA ORF Clone, Human, N-OFPSpark® tag HG10571-ANR
    TCPTP cDNA ORF Clone, Human, N-OFPSpark® tag HG10570-ANR
    TCPTP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10571-CF
    TCPTP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10570-CF
    TCPTP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10571-NF
    TCPTP cDNA ORF Clone, Human, C-His tag HG10571-CH
    TCPTP cDNA ORF Clone, Human, C-His tag HG10570-CH
    TCPTP cDNA ORF Clone, Human, N-His tag HG10571-NH
    TCPTP cDNA ORF Clone, Human, N-His tag HG10570-NH
    TCPTP cDNA ORF Clone, Human, C-HA tag HG10570-CY
    TCPTP cDNA ORF Clone, Human, C-HA tag HG10571-CY
    TCPTP cDNA ORF Clone, Human, N-HA tag HG10571-NY
    TCPTP cDNA ORF Clone, Human, N-HA tag HG10570-NY
    TCPTP cDNA ORF Clone, Human, C-Myc tag HG10571-CM
    TCPTP cDNA ORF Clone, Human, C-Myc tag HG10570-CM
    TCPTP cDNA ORF Clone, Human, N-Myc tag HG10571-NM
    TCPTP cDNA ORF Clone, Human, N-Myc tag HG10570-NM
    TCPTP qPCR Primer Pairs, Human HP100578
    info info
    添加购物车成功! 添加购物车失败!