Protein S cDNA ORF Clone, Human, C-Myc tag

Cat: HG12179-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Protein S Reagents
CRO Services
Product recommended

All Protein S Reagents
Protein S cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2076 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein S (alpha) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + NotI(6kb+2.08kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Protein S cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Protein S cDNA ORF Clone, Human, C-Myc tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5644
Protein S cDNA ORF Clone, Human, C-Myc tag Alternative Names
PROS cDNA ORF Clone, Human;Protein S cDNA ORF Clone, Human;PS21 cDNA ORF Clone, Human;PS22 cDNA ORF Clone, Human;PS23 cDNA ORF Clone, Human;PS24 cDNA ORF Clone, Human;PS25 cDNA ORF Clone, Human;PSA cDNA ORF Clone, Human;THPH5 cDNA ORF Clone, Human;THPH6 cDNA ORF Clone, Human
Protein S Background Information

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

Full Name
protein S (alpha)
References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
  • Protein S cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Protein S cDNA ORF Clone in Cloning Vector, Mouse MG5A0476-U
    Protein S cDNA ORF Clone, Mouse, untagged MG5A0476-UT
    Protein S cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0476-ACG
    Protein S Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0476-ACGLN
    Protein S cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0476-ACR
    Protein S cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0476-CF
    Protein S cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0476-NF
    Protein S cDNA ORF Clone, Mouse, C-His tag MG5A0476-CH
    Protein S cDNA ORF Clone, Mouse, N-His tag MG5A0476-NH
    Protein S cDNA ORF Clone, Mouse, C-HA tag MG5A0476-CY
    Protein S cDNA ORF Clone, Mouse, N-HA tag MG5A0476-NY
    Protein S cDNA ORF Clone, Mouse, C-Myc tag MG5A0476-CM
    Protein S cDNA ORF Clone, Mouse, N-Myc tag MG5A0476-NM

    Protein S cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Protein S cDNA ORF Clone in Cloning Vector, Human HG12179-G
    Protein S cDNA ORF Clone, Human, untagged HG12179-UT
    Protein S cDNA ORF Clone, Human, C-GFPSpark® tag HG12179-ACG
    Protein S Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12179-ACGLN
    Protein S cDNA ORF Clone, Human, C-OFPSpark® tag HG12179-ACR
    Protein S cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12179-CF
    Protein S cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12179-NF
    Protein S cDNA ORF Clone, Human, C-His tag HG12179-CH
    Protein S cDNA ORF Clone, Human, N-His tag HG12179-NH
    Protein S cDNA ORF Clone, Human, C-HA tag HG12179-CY
    Protein S cDNA ORF Clone, Human, N-HA tag HG12179-NY
    Protein S cDNA ORF Clone, Human, N-Myc tag HG12179-NM
    Protein S qPCR Primer Pairs, Human HP101835
    info info
    添加购物车成功! 添加购物车失败!