PrP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12070-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PrP Reagents
CRO Services
Product recommended

All PrP Reagents
PrP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
762 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prion protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PrP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PrP cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human PRNP / Prion protein Gene Expression validated Image 14459
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
PrP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
AltPrP cDNA ORF Clone, Human;ASCR cDNA ORF Clone, Human;CD230 cDNA ORF Clone, Human;CJD cDNA ORF Clone, Human;GSS cDNA ORF Clone, Human;KURU cDNA ORF Clone, Human;p27-30 cDNA ORF Clone, Human;PRIP cDNA ORF Clone, Human;PrP cDNA ORF Clone, Human;PrP27-30 cDNA ORF Clone, Human;PrP33-35C cDNA ORF Clone, Human;PrPc cDNA ORF Clone, Human
PrP Background Information
Full Name
prion protein

PrP cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PrP cDNA ORF Clone in Cloning Vector, Rhesus CG90244-G
PrP cDNA ORF Clone, Rhesus, untagged CG90244-UT
PrP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90244-ACG
PrP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90244-ACGLN
PrP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90244-ACR
PrP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90244-CF
PrP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90244-NF
PrP cDNA ORF Clone, Rhesus, C-His tag CG90244-CH
PrP cDNA ORF Clone, Rhesus, N-His tag CG90244-NH
PrP cDNA ORF Clone, Rhesus, C-HA tag CG90244-CY
PrP cDNA ORF Clone, Rhesus, N-HA tag CG90244-NY
PrP cDNA ORF Clone, Rhesus, C-Myc tag CG90244-CM
PrP cDNA ORF Clone, Rhesus, N-Myc tag CG90244-NM

PrP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PrP cDNA ORF Clone in Cloning Vector, Rat RG80379-G
PrP cDNA ORF Clone, Rat, untagged RG80379-UT
PrP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80379-ACGLN
PrP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80379-ACG
PrP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80379-ACR
PrP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80379-CF
PrP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80379-NF
PrP cDNA ORF Clone, Rat, C-His tag RG80379-CH
PrP cDNA ORF Clone, Rat, N-His tag RG80379-NH
PrP cDNA ORF Clone, Rat, C-HA tag RG80379-CY
PrP cDNA ORF Clone, Rat, N-HA tag RG80379-NY
PrP cDNA ORF Clone, Rat, C-Myc tag RG80379-CM
PrP cDNA ORF Clone, Rat, N-Myc tag RG80379-NM
PrP qPCR Primer Pairs, Rat RP300346

PrP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PrP cDNA ORF Clone in Cloning Vector, Mouse MG50878-G
PrP cDNA ORF Clone, Mouse, untagged MG50878-UT
PrP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50878-ACGLN
PrP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50878-ACG
PrP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50878-ACR
PrP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50878-CF
PrP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50878-NF
PrP cDNA ORF Clone, Mouse, C-His tag MG50878-CH
PrP cDNA ORF Clone, Mouse, N-His tag MG50878-NH
PrP cDNA ORF Clone, Mouse, C-HA tag MG50878-CY
PrP cDNA ORF Clone, Mouse, N-HA tag MG50878-NY
PrP cDNA ORF Clone, Mouse, C-Myc tag MG50878-CM
PrP cDNA ORF Clone, Mouse, N-Myc tag MG50878-NM
PrP qPCR Primer Pairs, Mouse MP200849

PrP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PrP cDNA ORF Clone in Cloning Vector, Human HG12070-G
PrP cDNA ORF Clone, Human, untagged HG12070-UT
PrP cDNA ORF Clone, Human, C-GFPSpark® tag HG12070-ACG
PrP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12070-ACGLN
PrP cDNA ORF Clone, Human, C-OFPSpark® tag HG12070-ACR
PrP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12070-CF
PrP cDNA ORF Clone, Human, C-His tag HG12070-CH
PrP cDNA ORF Clone, Human, N-His tag HG12070-NH
PrP cDNA ORF Clone, Human, C-HA tag HG12070-CY
PrP cDNA ORF Clone, Human, N-HA tag HG12070-NY
PrP cDNA ORF Clone, Human, C-Myc tag HG12070-CM
PrP cDNA ORF Clone, Human, N-Myc tag HG12070-NM
PrP qPCR Primer Pairs, Human HP101599
info info
添加购物车成功! 添加购物车失败!