PRKAR2B cDNA ORF Clone, Human, N-Myc tag

Cat: HG15468-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRKAR2B Reagents
CRO Services
Product recommended

All PRKAR2B Reagents
PRKAR2B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Human protein kinase, cAMP-dependent, regulatory, type II, beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKAR2B cDNA ORF Clone, Human, N-Myc tag Alternative Names
PRKAR2 cDNA ORF Clone, Human;RII-BETA cDNA ORF Clone, Human
PRKAR2B Background Information
Full Name
protein kinase, cAMP-dependent, regulatory, type II, beta

PRKAR2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKAR2B cDNA ORF Clone in Cloning Vector, Mouse MG58428-U
PRKAR2B cDNA ORF Clone, Mouse, untagged MG58428-UT
PRKAR2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58428-ACG
PRKAR2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58428-ACGLN
PRKAR2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58428-ANG
PRKAR2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58428-ACR
PRKAR2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58428-ANR
PRKAR2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58428-CF
PRKAR2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58428-NF
PRKAR2B cDNA ORF Clone, Mouse, C-His tag MG58428-CH
PRKAR2B cDNA ORF Clone, Mouse, N-His tag MG58428-NH
PRKAR2B cDNA ORF Clone, Mouse, C-HA tag MG58428-CY
PRKAR2B cDNA ORF Clone, Mouse, N-HA tag MG58428-NY
PRKAR2B cDNA ORF Clone, Mouse, C-Myc tag MG58428-CM
PRKAR2B cDNA ORF Clone, Mouse, N-Myc tag MG58428-NM

PRKAR2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKAR2B cDNA ORF Clone in Cloning Vector, Human HG15468-G
PRKAR2B cDNA ORF Clone, Human, untagged HG15468-UT
PRKAR2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15468-ACGLN
PRKAR2B cDNA ORF Clone, Human, C-GFPSpark® tag HG15468-ACG
PRKAR2B cDNA ORF Clone, Human, C-OFPSpark® tag HG15468-ACR
PRKAR2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15468-CF
PRKAR2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15468-NF
PRKAR2B cDNA ORF Clone, Human, C-His tag HG15468-CH
PRKAR2B cDNA ORF Clone, Human, N-His tag HG15468-NH
PRKAR2B cDNA ORF Clone, Human, C-HA tag HG15468-CY
PRKAR2B cDNA ORF Clone, Human, N-HA tag HG15468-NY
PRKAR2B cDNA ORF Clone, Human, C-Myc tag HG15468-CM
PRKAR2B qPCR Primer Pairs, Human HP104091
info info
添加购物车成功! 添加购物车失败!