PRELP cDNA ORF Clone, Human, C-Myc tag

Cat: HG13538-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PRELP Reagents

CRO Services

Product recommended


All PRELP Reagents

PRELP cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Human proline/arginine-rich end leucine-rich repeat prot with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRELP cDNA ORF Clone, Human, C-Myc tag Alternative Names

MST161 cDNA ORF Clone, Human;MSTP161 cDNA ORF Clone, Human;SLRR2A cDNA ORF Clone, Human

PRELP Background Information

Full Name
proline/arginine-rich end leucine-rich repeat protein

PRELP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRELP cDNA ORF Clone in Cloning Vector, Mouse MG52428-U
PRELP cDNA ORF Clone, Mouse, untagged MG52428-UT
PRELP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52428-ACG
PRELP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52428-ACGLN
PRELP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52428-ACR
PRELP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52428-CF
PRELP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52428-NF
PRELP cDNA ORF Clone, Mouse, C-His tag MG52428-CH
PRELP cDNA ORF Clone, Mouse, N-His tag MG52428-NH
PRELP cDNA ORF Clone, Mouse, C-HA tag MG52428-CY
PRELP cDNA ORF Clone, Mouse, N-HA tag MG52428-NY
PRELP cDNA ORF Clone, Mouse, C-Myc tag MG52428-CM
PRELP cDNA ORF Clone, Mouse, N-Myc tag MG52428-NM
PRELP qPCR Primer Pairs, Mouse MP202301

PRELP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRELP cDNA ORF Clone in Cloning Vector, Human HG13538-U
PRELP cDNA ORF Clone, Human, untagged HG13538-UT
PRELP cDNA ORF Clone, Human, C-GFPSpark® tag HG13538-ACG
PRELP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13538-ACGLN
PRELP cDNA ORF Clone, Human, C-OFPSpark® tag HG13538-ACR
PRELP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13538-CF
PRELP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13538-NF
PRELP cDNA ORF Clone, Human, C-His tag HG13538-CH
PRELP cDNA ORF Clone, Human, N-His tag HG13538-NH
PRELP cDNA ORF Clone, Human, C-HA tag HG13538-CY
PRELP cDNA ORF Clone, Human, N-HA tag HG13538-NY
PRELP cDNA ORF Clone, Human, N-Myc tag HG13538-NM
PRELP qPCR Primer Pairs, Human HP102224
info info
添加购物车成功! 添加购物车失败!