PPHLN1 cDNA ORF Clone, Human, C-His tag

Cat: HG15157-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PPHLN1 Reagents

CRO Services

Product recommended


All PPHLN1 Reagents

PPHLN1 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Human periphilin 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPHLN1 cDNA ORF Clone, Human, C-His tag Alternative Names

HSPC206 cDNA ORF Clone, Human;HSPC232 cDNA ORF Clone, Human

PPHLN1 Background Information

Full Name
periphilin 1

PPHLN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPHLN1 cDNA ORF Clone in Cloning Vector, Mouse MG53212-G
PPHLN1 cDNA ORF Clone, Mouse, untagged MG53212-UT
PPHLN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53212-ACGLN
PPHLN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53212-ACG
PPHLN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53212-ANG
PPHLN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53212-ACR
PPHLN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53212-ANR
PPHLN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53212-CF
PPHLN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53212-NF
PPHLN1 cDNA ORF Clone, Mouse, C-His tag MG53212-CH
PPHLN1 cDNA ORF Clone, Mouse, N-His tag MG53212-NH
PPHLN1 cDNA ORF Clone, Mouse, C-HA tag MG53212-CY
PPHLN1 cDNA ORF Clone, Mouse, N-HA tag MG53212-NY
PPHLN1 cDNA ORF Clone, Mouse, C-Myc tag MG53212-CM
PPHLN1 cDNA ORF Clone, Mouse, N-Myc tag MG53212-NM

PPHLN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPHLN1 cDNA ORF Clone in Cloning Vector, Human HG15157-G
PPHLN1 cDNA ORF Clone, Human, untagged HG15157-UT
PPHLN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15157-ACG
PPHLN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15157-ACGLN
PPHLN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15157-ANG
PPHLN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15157-ACR
PPHLN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15157-ANR
PPHLN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15157-CF
PPHLN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15157-NF
PPHLN1 cDNA ORF Clone, Human, N-His tag HG15157-NH
PPHLN1 cDNA ORF Clone, Human, C-HA tag HG15157-CY
PPHLN1 cDNA ORF Clone, Human, N-HA tag HG15157-NY
PPHLN1 cDNA ORF Clone, Human, C-Myc tag HG15157-CM
PPHLN1 cDNA ORF Clone, Human, N-Myc tag HG15157-NM
PPHLN1 qPCR Primer Pairs, Human HP103784
info info
添加购物车成功! 添加购物车失败!