PMF1 cDNA ORF Clone, Human, untagged

Cat: HG15235-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PMF1 Reagents
CRO Services
Product recommended

All PMF1 Reagents
PMF1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Human polyamine-modulated factor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PMF1 Background Information
Full Name
polyamine-modulated factor 1

PMF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PMF1 cDNA ORF Clone in Cloning Vector, Mouse MG5A2982-U
PMF1 cDNA ORF Clone, Mouse, untagged MG5A2982-UT
PMF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2982-ACGLN
PMF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2982-ACG
PMF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2982-ANG
PMF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2982-ACR
PMF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2982-ANR
PMF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2982-CF
PMF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2982-NF
PMF1 cDNA ORF Clone, Mouse, C-His tag MG5A2982-CH
PMF1 cDNA ORF Clone, Mouse, N-His tag MG5A2982-NH
PMF1 cDNA ORF Clone, Mouse, C-HA tag MG5A2982-CY
PMF1 cDNA ORF Clone, Mouse, N-HA tag MG5A2982-NY
PMF1 cDNA ORF Clone, Mouse, C-Myc tag MG5A2982-CM
PMF1 cDNA ORF Clone, Mouse, N-Myc tag MG5A2982-NM

PMF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PMF1 cDNA ORF Clone in Cloning Vector, Human HG15235-G
PMF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15235-ACG
PMF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15235-ACGLN
PMF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15235-ANG
PMF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15235-ACR
PMF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15235-ANR
PMF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15235-CF
PMF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15235-NF
PMF1 cDNA ORF Clone, Human, C-His tag HG15235-CH
PMF1 cDNA ORF Clone, Human, N-His tag HG15235-NH
PMF1 cDNA ORF Clone, Human, C-HA tag HG15235-CY
PMF1 cDNA ORF Clone, Human, N-HA tag HG15235-NY
PMF1 cDNA ORF Clone, Human, C-Myc tag HG15235-CM
PMF1 cDNA ORF Clone, Human, N-Myc tag HG15235-NM
PMF1 qPCR Primer Pairs, Human HP103861
info info
添加购物车成功! 添加购物车失败!