PLTP cDNA ORF Clone, Human, N-HA tag

Cat: HG11171-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLTP Reagents
CRO Services
Product recommended

All PLTP Reagents
PLTP cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Human phospholipid transfer protein, transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLTP cDNA ORF Clone, Human, N-HA tag Alternative Names
BPIFE cDNA ORF Clone, Human;HDLCQ9 cDNA ORF Clone, Human
PLTP Background Information

Phospholipid transfer protein, also known as Lipid transfer protein II and PLTP, is a secreted protein which belongs to the BPI/LBP/Plunc superfamily and BPI / LBP family. PLTP is nearly ubiquitously expressed in cells and tissues. PLTP converts HDL into larger and smaller particles. It may play a key role in extracellular phospholipid transport and modulation of hdl particles. High-density lipoproteins (HDL) play a major protective role against the development of coronary artery disease. PLTP is a main factor regulating the size and composition of HDL in the circulation and plays an important role in controlling plasma HDL levels. This is achieved via both the phospholipid transfer activity of PLTP and its capability to cause HDL conversion. PLTP is one of the key lipid transfer proteins in plasma and cerebrospinal fluid. It is involved in novel intracellular functions. PLTP is an important modulator of lipoprotein metabolism, including interparticle phospholipid transfer, remodeling of HDL, cholesterol and phospholipid efflux from peripheral tissues, and the production of hepatic VLDL. PLTP also plays an important role in inflammation and oxidative stress. Accordingly, PLTP has also been implicated in the development of atherosclerosis.

Full Name
phospholipid transfer protein
References
  • Huuskonen, J. et al., 2000, Atherosclerosis. 151 (2): 451-61.
  • Huuskonen,J. et al., 2001, Atherosclerosis. 155 (2): 269-81.
  • Valenta,D.T. et al., 2008, J Lipid Res. 49 (1): 24-32.
  • Vuletic,S. et al., 2009, Biochim Biophys Acta. 1793 (3): 584-91.
  • Chen, X. et al., 2009, Nutr Metab. 6 : 49.
  • PLTP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PLTP cDNA ORF Clone in Cloning Vector, Rat RG85363-U
    PLTP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85363-ACGLN

    PLTP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PLTP cDNA ORF Clone in Cloning Vector, Mouse MG52423-G
    PLTP cDNA ORF Clone, Mouse, untagged MG52423-UT
    PLTP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52423-ACG
    PLTP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52423-ACGLN
    PLTP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52423-ACR
    PLTP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52423-CF
    PLTP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52423-NF
    PLTP cDNA ORF Clone, Mouse, C-His tag MG52423-CH
    PLTP cDNA ORF Clone, Mouse, N-His tag MG52423-NH
    PLTP cDNA ORF Clone, Mouse, C-HA tag MG52423-CY
    PLTP cDNA ORF Clone, Mouse, N-HA tag MG52423-NY
    PLTP cDNA ORF Clone, Mouse, C-Myc tag MG52423-CM
    PLTP cDNA ORF Clone, Mouse, N-Myc tag MG52423-NM
    PLTP qPCR Primer Pairs, Mouse MP202296

    PLTP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PLTP cDNA ORF Clone in Cloning Vector, Human HG11171-M
    PLTP cDNA ORF Clone, Human, untagged HG11171-UT
    PLTP cDNA ORF Clone, Human, C-GFPSpark® tag HG11171-ACG
    PLTP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11171-ACGLN
    PLTP cDNA ORF Clone, Human, C-OFPSpark® tag HG11171-ACR
    PLTP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11171-CF
    PLTP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11171-NF
    PLTP cDNA ORF Clone, Human, C-His tag HG11171-CH
    PLTP cDNA ORF Clone, Human, N-His tag HG11171-NH
    PLTP cDNA ORF Clone, Human, C-HA tag HG11171-CY
    PLTP cDNA ORF Clone, Human, C-Myc tag HG11171-CM
    PLTP cDNA ORF Clone, Human, N-Myc tag HG11171-NM
    PLTP qPCR Primer Pairs, Human HP101077
    info info
    添加购物车成功! 添加购物车失败!