ADFP cDNA ORF Clone, Human, N-Myc tag

Cat: HG14900-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADFP Reagents
CRO Services
Product recommended

All ADFP Reagents
ADFP cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Human perilipin 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADFP cDNA ORF Clone, Human, N-Myc tag Alternative Names
ADFP cDNA ORF Clone, Human;ADRP cDNA ORF Clone, Human
ADFP Background Information
Full Name
perilipin 2

ADFP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADFP cDNA ORF Clone in Cloning Vector, Mouse MG53950-G
ADFP cDNA ORF Clone, Mouse, untagged MG53950-UT
ADFP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53950-ACG
ADFP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53950-ACGLN
ADFP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53950-ANG
ADFP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53950-ACR
ADFP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53950-ANR
ADFP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53950-CF
ADFP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53950-NF
ADFP cDNA ORF Clone, Mouse, C-His tag MG53950-CH
ADFP cDNA ORF Clone, Mouse, N-His tag MG53950-NH
ADFP cDNA ORF Clone, Mouse, C-HA tag MG53950-CY
ADFP cDNA ORF Clone, Mouse, N-HA tag MG53950-NY
ADFP cDNA ORF Clone, Mouse, C-Myc tag MG53950-CM
ADFP cDNA ORF Clone, Mouse, N-Myc tag MG53950-NM

ADFP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADFP cDNA ORF Clone in Cloning Vector, Human HG14900-G
ADFP cDNA ORF Clone, Human, untagged HG14900-UT
ADFP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14900-ACGLN
ADFP cDNA ORF Clone, Human, C-GFPSpark® tag HG14900-ACG
ADFP cDNA ORF Clone, Human, N-GFPSpark® tag HG14900-ANG
ADFP cDNA ORF Clone, Human, C-OFPSpark® tag HG14900-ACR
ADFP cDNA ORF Clone, Human, N-OFPSpark® tag HG14900-ANR
ADFP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14900-CF
ADFP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14900-NF
ADFP cDNA ORF Clone, Human, C-His tag HG14900-CH
ADFP cDNA ORF Clone, Human, N-His tag HG14900-NH
ADFP cDNA ORF Clone, Human, C-HA tag HG14900-CY
ADFP cDNA ORF Clone, Human, N-HA tag HG14900-NY
ADFP cDNA ORF Clone, Human, C-Myc tag HG14900-CM
ADFP qPCR Primer Pairs, Human HP103529
info info
添加购物车成功! 添加购物车失败!