PFKL cDNA ORF Clone, Human, untagged

Cat: HG14223-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PFKL Reagents

CRO Services

Product recommended


All PFKL Reagents

PFKL cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Human phosphofructokinase, liver.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFKL cDNA ORF Clone, Human, untagged Alternative Names

ATP-PFK cDNA ORF Clone, Human;PFK-B cDNA ORF Clone, Human;PFK-L cDNA ORF Clone, Human

PFKL Background Information

Full Name
phosphofructokinase, liver

PFKL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PFKL cDNA ORF Clone in Cloning Vector, Mouse MG52702-G
PFKL cDNA ORF Clone, Mouse, untagged MG52702-UT
PFKL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52702-ACG
PFKL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52702-ACGLN
PFKL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52702-ANG
PFKL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52702-ACR
PFKL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52702-ANR
PFKL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52702-CF
PFKL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52702-NF
PFKL cDNA ORF Clone, Mouse, C-His tag MG52702-CH
PFKL cDNA ORF Clone, Mouse, N-His tag MG52702-NH
PFKL cDNA ORF Clone, Mouse, C-HA tag MG52702-CY
PFKL cDNA ORF Clone, Mouse, N-HA tag MG52702-NY
PFKL cDNA ORF Clone, Mouse, C-Myc tag MG52702-CM
PFKL cDNA ORF Clone, Mouse, N-Myc tag MG52702-NM
PFKL qPCR Primer Pairs, Mouse MP202573

PFKL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PFKL cDNA ORF Clone in Cloning Vector, Human HG14223-G
PFKL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14223-ACGLN
PFKL cDNA ORF Clone, Human, C-GFPSpark® tag HG14223-ACG
PFKL cDNA ORF Clone, Human, N-GFPSpark® tag HG14223-ANG
PFKL cDNA ORF Clone, Human, C-OFPSpark® tag HG14223-ACR
PFKL cDNA ORF Clone, Human, N-OFPSpark® tag HG14223-ANR
PFKL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14223-CF
PFKL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14223-NF
PFKL cDNA ORF Clone, Human, C-His tag HG14223-CH
PFKL cDNA ORF Clone, Human, N-His tag HG14223-NH
PFKL cDNA ORF Clone, Human, C-HA tag HG14223-CY
PFKL cDNA ORF Clone, Human, N-HA tag HG14223-NY
PFKL cDNA ORF Clone, Human, C-Myc tag HG14223-CM
PFKL cDNA ORF Clone, Human, N-Myc tag HG14223-NM
PFKL qPCR Primer Pairs, Human HP102873
info info
添加购物车成功! 添加购物车失败!