PDK4 cDNA ORF Clone, Human, N-His tag

Cat: HG10743-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PDK4 Reagents

CRO Services

Product recommended


All PDK4 Reagents

PDK4 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 4 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDK4 Background Information

Full Name
pyruvate dehydrogenase kinase 4

PDK4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDK4 cDNA ORF Clone in Cloning Vector, Rat RG82369-U
PDK4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82369-ACGLN

PDK4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDK4 cDNA ORF Clone in Cloning Vector, Mouse MG51021-G
PDK4 cDNA ORF Clone, Mouse, untagged MG51021-UT
PDK4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51021-ACGLN
PDK4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51021-ACG
PDK4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51021-ANG
PDK4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51021-ACR
PDK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51021-ANR
PDK4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51021-CF
PDK4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51021-NF
PDK4 cDNA ORF Clone, Mouse, C-His tag MG51021-CH
PDK4 cDNA ORF Clone, Mouse, N-His tag MG51021-NH
PDK4 cDNA ORF Clone, Mouse, C-HA tag MG51021-CY
PDK4 cDNA ORF Clone, Mouse, N-HA tag MG51021-NY
PDK4 cDNA ORF Clone, Mouse, C-Myc tag MG51021-CM
PDK4 cDNA ORF Clone, Mouse, N-Myc tag MG51021-NM
PDK4 qPCR Primer Pairs, Mouse MP200980

PDK4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDK4 cDNA ORF Clone in Cloning Vector, Human HG10743-G
PDK4 cDNA ORF Clone, Human, untagged HG10743-UT
PDK4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10743-ACGLN
PDK4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10743-ACG
PDK4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10743-ANG
PDK4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10743-ACR
PDK4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10743-ANR
PDK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10743-CF
PDK4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10743-NF
PDK4 cDNA ORF Clone, Human, C-His tag HG10743-CH
PDK4 cDNA ORF Clone, Human, C-HA tag HG10743-CY
PDK4 cDNA ORF Clone, Human, N-HA tag HG10743-NY
PDK4 cDNA ORF Clone, Human, C-Myc tag HG10743-CM
PDK4 cDNA ORF Clone, Human, N-Myc tag HG10743-NM
PDK4 qPCR Primer Pairs, Human HP100676
info info
添加购物车成功! 添加购物车失败!