PCDHGC4 cDNA ORF Clone, Human, C-His tag

Cat: HG13394-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PCDHGC4 Reagents

CRO Services

Product recommended


All PCDHGC4 Reagents

PCDHGC4 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2817 bp
Description
Full length Clone DNA of Human protocadherin gamma subfamily C, 4 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCDHGC4 cDNA ORF Clone, Human, C-His tag Alternative Names

PCDH-GAMMA-C4 cDNA ORF Clone, Human

PCDHGC4 Background Information

Full Name
protocadherin gamma subfamily C, 4

PCDHGC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCDHGC4 cDNA ORF Clone in Cloning Vector, Human HG13394-G
PCDHGC4 cDNA ORF Clone in Cloning Vector, Human HG15753-G
PCDHGC4 cDNA ORF Clone, Human, untagged HG13394-UT
PCDHGC4 cDNA ORF Clone, Human, untagged HG15753-UT
PCDHGC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15753-ACG
PCDHGC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13394-ACG
PCDHGC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13394-ACGLN
PCDHGC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15753-ACGLN
PCDHGC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15753-ACR
PCDHGC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13394-ACR
PCDHGC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13394-CF
PCDHGC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15753-CF
PCDHGC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15753-NF
PCDHGC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13394-NF
PCDHGC4 cDNA ORF Clone, Human, C-His tag HG15753-CH
PCDHGC4 cDNA ORF Clone, Human, N-His tag HG15753-NH
PCDHGC4 cDNA ORF Clone, Human, N-His tag HG13394-NH
PCDHGC4 cDNA ORF Clone, Human, C-HA tag HG13394-CY
PCDHGC4 cDNA ORF Clone, Human, C-HA tag HG15753-CY
PCDHGC4 cDNA ORF Clone, Human, N-HA tag HG15753-NY
PCDHGC4 cDNA ORF Clone, Human, N-HA tag HG13394-NY
PCDHGC4 cDNA ORF Clone, Human, C-Myc tag HG13394-CM
PCDHGC4 cDNA ORF Clone, Human, C-Myc tag HG15753-CM
PCDHGC4 cDNA ORF Clone, Human, N-Myc tag HG15753-NM
PCDHGC4 cDNA ORF Clone, Human, N-Myc tag HG13394-NM
PCDHGC4 qPCR Primer Pairs, Human HP102098
info info
添加购物车成功! 添加购物车失败!